Probing the Effects of Chemical Modifications on Anticoagulant and Antiproliferative Activity of Thrombin Binding Aptamer.

Thrombin binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers that efficiently binds to thrombin, resulting in anticoagulant effects. TBA also possesses promising antiproliferative properties. As with most therapeutic oligonucleotides, chemical modifications are critical for therapeutic applications, particularly to improve thermodynamic stability, resistance in biological environment, and target affinity.

Aptamer-Drug conjugates for a targeted and synergistic anticancer Response: Exploiting T30923-5-fluoro-2'-deoxyuridine (INT-FdU) derivatives.

One of the most appealing approaches for cancer treatment is targeted therapy, which is based on the use of drugs able to target cancer cells without affecting normal ones. This strategy lets to overcome the major limitation of conventional chemotherapy, namely the lack of specificity of anticancer drugs, which often leads to severe side effects, decreasing the therapy effectiveness. Delivery of cell-killing substances to tumor cells is one-way targeted drug therapy can work.

Improving the Biological Properties of Thrombin-Binding Aptamer by Incorporation of 8-Bromo-2'-Deoxyguanosine and 2'-Substituted RNA Analogues.

Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can efficiently bind to thrombin, thus producing an anticoagulant effect. The major limit to its therapeutic application is represented by its poor thermal and biological resistance.

Structural and Biological Features of G-Quadruplex Aptamers as Promising Inhibitors of the STAT3 Signaling Pathway.

In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce its levels or activity in cancer has noteworthy therapeutic potential. T40214 () [(GC)] is a G4 aptamer that can influence STAT3 biological outcomes in an efficient manner in several cancer cells.

Properties and Potential Antiproliferative Activity of Thrombin-Binding Aptamer (TBA) Derivatives with One or Two Additional G-Tetrads.

In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop at the top (TBAG4GS) of the TBAG4 structure has been completely modified by replacing all loop residues with abasic site mimics. The therapeutical development of the TBA was hindered by its low thermodynamic and nuclease stability, while its potential as an anticancer/antiproliferative molecule is also affected by the anticoagulant activity, being a side effect in this case. In order to obtain suitable TBA analogs and to explore the involvement of specific aptamer regions in biological activity, the antiproliferative capability against DU 145 and MDAMB 231 cancer cell lines (MTT), the anticoagulant properties (PT), the biological degradability (nuclease stability assay) and nucleolin (NCL) binding ability (SPR) of the above described TBA derivatives have been tested.

Antiproliferative Effects of the Aptamer d(GGGT) and Its Analogues with an Abasic-Site Mimic Loop on Different Cancer Cells.

In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with an abasic site mimic (S). G-rich oligonucleotides (GRO) show interesting anticancer properties because of their capability to adopt G-quadruplex structures (G4s), such as the G4 HIV-1 integrase inhibitor T30923. Considering the multi-targeted effects of G4-aptamers and the limited number of cancer cell lines tested, particularly for T30923, it should be important to find a suitable tumor line, in addition to considering that the effects also strictly depend on G4s.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (A), 8-oxo-2'-deoxyadenosine (A) or β-L-2'-deoxyadenosine (A) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate.

Exploring New Potential Anticancer Activities of the G-Quadruplexes Formed by [(GTGT(GT)] and Its Derivatives with an Abasic Site Replacing Single Thymidine.

In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in comparison to their natural counterpart in order to evaluate their antiproliferative potential and the involvement of the residues not belonging to the central core of stacked guanosines in biological activity. The collected NMR (Nuclear Magnetic Resonance), CD (Circular Dichroism), and PAGE (Polyacrylamide Gel Electrophoresis) data strongly suggest that all of them adopt G-quadruplex (G4) structures strictly similar to that of the parent aptamer with the ability to fold into a dimeric structure composed of two identical G-quadruplexes, each characterized by parallel strands, three all-G-tetrads and four one-thymidine loops (one bulge and three propeller loops). Furthermore, their antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against lung and colorectal cancer cells were tested.

Aptamers against the β-Conglutin Allergen: Insights into the Behavior of the Shortest Multimeric (Intra)Molecular DNA G-Quadruplex.

In previous work, a 93-mer aptamer was selected against the anaphylactic allergen, β-conglutin and truncated to an 11-mer, improving the affinity by two orders of magnitude, whilst maintaining the specificity. This 11-mer was observed to fold in a G-quadruplex, and preliminary results indicated the existence of a combination of monomeric and higher-order structures. Building on this previous work, in the current study, we aimed to elucidate a deeper understanding of the structural forms of this 11-mer and the effect of the structure on its binding ability.

Structural properties and anticoagulant/cytotoxic activities of heterochiral enantiomeric thrombin binding aptamer (TBA) derivatives.

The thrombin binding aptamer (TBA) possesses promising antiproliferative properties. However, its development as an anticancer agent is drastically impaired by its concomitant anticoagulant activity. Therefore, suitable chemical modifications in the TBA sequence would be required in order to preserve its antiproliferative over anticoagulant activity.

Novel monomolecular derivatives of the anti-HIV-1 G-quadruplex-forming Hotoda's aptamer containing inversion of polarity sites.

Here we report on the design, preparation and investigation of four analogues of the anti-HIV G-quadruplex-forming Hotoda's aptamer, based on an unprecedented linear topology. In these derivatives, four TGGGAGT tracts have been joined together by exploiting 3'-3' and 5'-5' inversion of polarity sites formed by canonical phosphodiester bonds or a glycerol-based linker. Circular dichroism data suggest that all oligodeoxynucleotides fold in monomolecular G-quadruplex structures characterized by a parallel strand orientation and three side loops connecting 3'- or 5'-ends.

Influence of COVID-19 pandemic on the psychological status of infertile couples.

Objective(s): to evaluate the impact of the COVID-19 pandemic on infertile couples' emotions, anxiety and future plans.

Study Design: An observational study was perfomed by Italian ART centers and online forums. In this study, infertile couples candidate to ART and whose treatment was blocked due to the COVID-19 lockdown were enrolled through an online survey.

Probing the Importance of the G-Quadruplex Grooves for the Activity of the Anti-HIV-Integrase Aptamer T30923.

In this paper, we report studies concerning four variants of the G-quadruplex forming anti-HIV-integrase aptamer T30923, in which specific 2'-deoxyguanosines have been singly replaced by 8-methyl-2'-deoxyguanosine residues, with the aim to exploit the methyl group positioned in the G-quadruplex grooves as a steric probe to investigate the interaction aptamer/target. Although, the various modified aptamers differ in the localization of the methyl group, NMR, circular dichroism (CD), electrophoretic and molecular modeling data suggest that all of them preserve the ability to fold in a stable dimeric parallel G-quadruplex complex resembling that of their natural counterpart T30923. However, the biological data have shown that the T30923 variants are characterized by different efficiencies in inhibiting the HIV-integrase, thus suggesting the involvement of the G-quadruplex grooves in the aptamer/target interaction.

uL3 Mediated Nucleolar Stress Pathway as a New Mechanism of Action of Antiproliferative G-quadruplex TBA Derivatives in Colon Cancer Cells.

The antiproliferative G-quadruplex aptamers are a promising and challenging subject in the framework of the anticancer therapeutic oligonucleotides research field. Although several antiproliferative G-quadruplex aptamers have been identified and proven to be effective on different cancer cell lines, their mechanism of action is still unexplored. We have recently described the antiproliferative activity of a heterochiral thrombin binding aptamer (TBA) derivative, namely, LQ1.

Improved performances of catalytic G-quadruplexes (G4-DNAzymes) via the chemical modifications of the DNA backbone to provide G-quadruplexes with double 3'-external G-quartets.

Here we report on the design of a new catalytic G-quadruplex-DNA system (G4-DNAzyme) based on the modification of the DNA scaffold to provide the DNA pre-catalyst with two identical 3'-ends, known to be more catalytically proficient than the 5'-ends. To this end, we introduced a 5'-5' inversion of polarity site in the middle of the G4-forming sequences AGA and AGA to obtain d(AGG-GGA) (or AG-GA) and d(AGGG-GGGA) (or AG-GA) that fold into stable G4 whose tetramolecular nature was confirmed via nuclear magnetic resonance (NMR) and circular dichroism (CD) investigations. Both AG-GA and AG-GA display two identical external G-quartets (3'-ends) known to interact with the cofactor hemin with a high efficiency, making the resulting complex competent to perform hemoprotein-like catalysis (G4-DNAzyme).

Investigating the properties of TBA variants with twin thrombin binding domains.

In this paper, we report studies concerning thrombin binding aptamer (TBA) dimeric derivatives in which the 3'-ends of two TBA sequences have been joined by means of linkers containing adenosine or thymidine residues and/or a glycerol moiety. CD and electrophoretic investigations indicate that all modified aptamers are able to form G-quadruplex domains resembling that of the parent TBA structure. However, isothermal titration calorimetry measurements of the aptamer/thrombin interaction point to different affinities to the target protein, depending on the type of linker.

Human AP-endonuclease (Ape1) activity on telomeric G4 structures is modulated by acetylatable lysine residues in the N-terminal sequence.

Loss of telomeres stability is a hallmark of cancer cells. Exposed telomeres are prone to aberrant end-joining reactions leading to chromosomal fusions and translocations. Human telomeres contain repeated TTAGGG elements, in which the 3' exposed strand may adopt a G-quadruplex (G4) structure.

Structural studies and biological evaluation of T30695 variants modified with single chiral glycerol-T reveal the importance of LEDGF/p75 for the aptamer anti-HIV-integrase activities.

Some G-quadruplex (GQ) forming aptamers, such as T30695, exhibit particularly promising properties among the potential anti-HIV drugs. T30695 G-quadruplex binds to HIV-1 integrase (IN) and inhibits its activity during 3'-end processing at nanomolar concentrations. Herein we report a study concerning six T30695-GQ variants, in which the R or S chiral glycerol T, singly replaced the thymine residues at the T30695 G-quadruplex loops.

Thrombin binding aptamer analogues containing inversion of polarity sites endowed with antiproliferative and anti-motility properties against Calu-6 cells.

Background: Although the thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative properties, it is possible to reduce the first and enhance the second one by suitable chemical modifications.

Methods: Two oligonucleotides (TBA353 and TBA535) based on the TBA sequence (GGTTGGTGTGGTTGG) and containing inversion of polarity sites have been investigated by CD, UV and electrophoretic techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay), antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against Calu-6 cells have been tested and compared with TBA.

Improvement of the activity of the anti-HIV-1 integrase aptamer T30175 by introducing a modified thymidine into the loops.

In this paper, we report our investigations on analogues of the anti-human immunodeficiency virus type 1 (HIV-1) integrase (IN) aptamer T30175 in which the individual thymidines forming the loops were replaced by 5-hydroxymethyl-2'-deoxyuridine residues (H). Circular dichroism, nuclear magnetic resonance and gel electrophoresis investigations clearly indicated that all the modified aptamers preserve the ability to form the original 5'-5' end-stacked head-to-head dimeric G-quadruplex structure, in which each G-quadruplex adopts a parallel arrangement and is characterized by three G-tetrads, three propeller loops and one bulge-loop. All the modified aptamers were tested in an IN inhibition LEDGF-independent assay.

The "Janus face" of the thrombin binding aptamer: Investigating the anticoagulant and antiproliferative properties through straightforward chemical modifications.

Background: The thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative activities. Its chemico-physical and/or biological properties can be tuned by the site-specific replacement of selected residues.

Methods: Four oligodeoxynucleotides (ODNs) based on the TBA sequence (5'-GGTTGGTGTGGTTGG-3') and containing 2'-deoxyuridine (U) or 5-bromo-2'-deoxyuridine (B) residues at positions 4 or 13 have been investigated by NMR and CD techniques.

Monomolecular G-quadruplex structures with inversion of polarity sites: new topologies and potentiality.

In this paper, we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy and electrophoresis methods, on three oligonucleotide sequences, each containing one 3'-3' and two 5'-5' inversion of polarity sites, and four G-runs with a variable number of residues, namely two, three and four (mTG2T, mTG3T and mTG4T with sequence 3'-TGnT-5'-5'-TGnT-3'-3'-TGnT-5'-5'-TGnT-3' in which n = 2, 3 and 4, respectively), in comparison with their canonical counterparts (TGnT)4 (n = 2, 3 and 4). Oligonucleotides mTG3T and mTG4T have been proven to form very stable unprecedented monomolecular parallel G-quadruplex structures, characterized by three side loops containing the inversion of polarity sites. Both G-quadruplexes have shown an all-syn G-tetrad, while the other guanosines adopt anti glycosidic conformations.

Optimization of benzoquinone and hydroquinone derivatives as potent inhibitors of human 5-lipoxygenase.

Aiming to assess the biological activities of synthetic 1,4-benzoquinones, we previously synthesized different libraries of benzoquinones with lipophilic and bulky alkyl- or aryl-substituents that inhibited 5-lipoxygenase (5-LO). The high potency of 4,5-dimethoxy-3-alkyl-1,2-benzoquinones on 5-LO led to the idea to further modify the structures and thus to improve the inhibitory potential in vitro and in vivo as well as to investigate SARs. Systematic structural optimization through accurate structure-based design resulted in compound 30 (3-tridecyl-4,5-dimethoxybenzene-1,2-diol), an ubiquinol derivative that exhibited the strongest anti-inflammatory effect, with a 10-fold improved 5-LO inhibitory activity (IC = 28 nM) in activated neutrophils.

BAG3 Protein Is Over-Expressed in Endometrioid Endometrial Adenocarcinomas.

Endometrioid endometrial cancer is the most common gynaecological tumor in developed countries, and its incidence is increasing. The definition of subtypes, based on clinical and endocrine features or on histopathological characteristics, correlate to some extent with patient's prognosis, but there is substantial heterogeneity within tumor types. The search for molecules and mechanisms implied in determining the progression and the response to therapy for this cancer is still ongoing.

Backbone modified TBA analogues endowed with antiproliferative activity.

Background: The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity.

Methods: Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested.