The Excited State Dynamics of a Mutagenic Guanosine Etheno Adduct Investigated by Femtosecond Fluorescence Spectroscopy and Quantum Mechanical Calculations.

Femtosecond fluorescence upconversion experiments were combined with CASPT2 and time dependent DFT calculations to characterize the excited state dynamics of the mutagenic etheno adduct 1,N-etheno-2'-deoxyguanosine (ϵdG). This endogenously formed lesion is attracting great interest because of its ubiquity in human tissues and its highly mutagenic properties. The ϵdG fluorescence is strongly modified with respect to that of the canonical nucleoside dG, notably by an about 6-fold increase in fluorescence lifetime and quantum yield at neutral pH.

The Ubiquity of High-Energy Nanosecond Fluorescence in DNA Duplexes.

During the past few years, several studies reported that a significant part of the intrinsic fluorescence of DNA duplexes decays with surprisingly long lifetimes (1-3 ns) at wavelengths shorter than the ππ* emission of their monomeric constituents. This high-energy nanosecond emission (HENE), hardly discernible in the steady-state fluorescence spectra of most duplexes, was investigated by time-correlated single-photon counting. The ubiquity of HENE contrasts with the paradigm that the longest-lived excited states correspond to low-energy excimers/exciplexes.

Fluorescence of Bimolecular Guanine Quadruplexes: From Femtoseconds to Nanoseconds.

The paper deals with the fluorescence of guanine quadruplexes (G4) formed by association of two DNA strands d(GGGGTTTTGGGG) in the presence of K cations, noted as OXY/K in reference to the protozoon , whose telomere contains TTTTGGGG repeats. They were studied by steady-state and time-resolved techniques, time-correlated single photon counting, and fluorescence upconversion. The maximum of the OXY/K fluorescence spectrum is located at 334 nm, and the quantum yield is 5.

High-Energy Long-Lived Emitting Mixed Excitons in Homopolymeric Adenine-Thymine DNA Duplexes.

The publication deals with polymeric pA●pT and oligomeric A●T DNA duplexes whose fluorescence is studied by time-correlated single photon counting. It is shown that their emission on the nanosecond timescale is largely dominated by high-energy components peaking at a wavelength shorter than 305 nm. Because of their anisotropy (0.

Exciton Cooling in 2D Perovskite Nanoplatelets: Rationalized Carrier-Induced Stark and Phonon Bottleneck Effects.

Using femtosecond transient absorption (fs-TA), we investigate the hot exciton relaxation dynamics in strongly confined lead iodide perovskite nanoplatelets (NPLs). The large quantum and dielectric confinement leads to discrete excitonic transitions and strong Stark features in the TA spectra. This prevents the use of conventional relaxation analysis methods extracting the carrier temperature or measuring the buildup of the band-edge bleaching.

The Excited State Dynamics of a Mutagenic Cytidine Etheno Adduct Investigated by Combining Time-Resolved Spectroscopy and Quantum Mechanical Calculations.

Joint femtosecond fluorescence upconversion experiments and theoretical calculations provide a hitherto unattained degree of characterization and understanding of the mutagenic etheno adduct 3,N4-etheno-2'-deoxycytidine (εdC) excited state relaxation. This endogenously formed lesion is attracting great interest because of its ubiquity in human tissues and its highly mutagenic properties. The εdC fluorescence is modified with respect to that of the canonical base dC, with a 3-fold increased lifetime and quantum yield at neutral pH.

Hole injection from P1 dye hot-excited states in p-type dye-sensitized films: a fluorescence study.

We present a study of the excited state relaxation dynamics of the photosensitizer P1 used in p-type dye-sensitized solar cells. Comparative femtosecond fluorescence upconversion measurements in solution and in films show that the dye undergoes a picosecond electronic relaxation from the bright Franck-Condon (FC) state to a low-emitting charge-transfer (CT) state in polar environment. The fluorescence is moderately quenched in solution and on the mesoporous AlO isolator but dramatically more on NiO semiconductor.

Fundamentals of the Intrinsic DNA Fluorescence.

The intrinsic fluorescence of nucleic acids is extremely weak compared to that of the fluorescent labels used to probe their structural and functional behavior. Thus, for technical reasons, the investigation of the intrinsic DNA fluorescence was limited for a long time. But with the improvement in spectroscopic techniques, the situation started to change around the turn of the century.

Excited State Dynamics of 8-Vinyldeoxyguanosine In Aqueous Solution Studied by Time-Resolved Fluorescence Spectroscopy and Quantum Mechanical Calculations.

The fluorescent base guanine analog, 8-vinyl-deoxyguanosine (8vdG), is studied in solution using a combination of optical spectroscopies, notably femtosecond fluorescence upconversion and quantum chemical calculations, based on time-dependent density functional theory (TD-DFT) and including solvent effect by using a mixed discrete-continuum model. In all investigated solvents, the fluorescence is very long lived (3-4 ns), emanating from a stable excited state minimum with pronounced intramolecular charge-transfer character. The main non-radiative decay channel features a sizeable energy barrier and it is affected by the polarity and the H-bonding properties of the solvent.

Excited State Lifetimes of Sulfur-Substituted DNA and RNA Monomers Probed Using the Femtosecond Fluorescence Up-Conversion Technique.

Sulfur-substituted DNA and RNA nucleobase derivatives (a.k.a.

Comprehensive Study of Guanine Excited State Relaxation and Photoreactivity in G-quadruplexes.

G-quadruplexes () are four-stranded DNA/RNA structures playing a key role in many biological functions and promising for nanotechnology applications. Here, combining theoretical calculations and multiscale time-resolved fluorescence, we describe, for the first time, an ensemble of photoactivated processes involving the guanines of the core. We use as showcase the formed by the human telomeric sequence GGG(TTAGGG) in the presence of Na ions.

Role of Electronic Relaxation in the Injection Process of Organic Push-Pull Dyes in Complete Dye-Sensitized Solar Cells.

There is a growing consensus that the charge separation taking place in dye-sensitized solar cells is a multiscale process occurring on a times scale from a few to hundreds of picoseconds. We studied the excited-state dynamics of the robust and efficient push-pull dye in solution, on mesoporous films and in complete photovoltaics cells by femtosecond fluorescence upconversion and transient absorption. In a polar environment and cells, the dynamics at early times are dominated by an intramolecular electronic relaxation, while electron injection is predominant on thin films only.

Multiscale time-resolved fluorescence study of a glycogen phosphorylase inhibitor combined with quantum chemistry calculations.

A fluorescence study of N1-(β-d-glucopyranosyl)-N4-[2-acridin-9(10H)-onyl]-cytosine (GLAC), the first fluorescent potent inhibitor of glycogen phosphorylase (GP), in neutral aqueous solution, is presented herein. Quantum chemistry (TD-DFT) calculations show the existence of several conformers both in the ground and first excited states. They result from rotations of the acridone and cytosine moieties around an NH bridge which may lead to the formation of non-emitting charge-transfer states.

Femtosecond Fluorescence Upconversion Study of a Naphthalimide-Bithiophene-Triphenylamine Push-Pull Dye in Solution.

There is a high interest in the development of new push-pull dyes for the use in dye sensitized solar cells. The pronounced charge transfer character of the directly photoexcited state is in principle favorable for a charge injection. Here, we report a time-resolved fluorescence study of a triphenylamine-bithiophene-naphthalimide dye in four solvents of varying polarity using fluorescence upconversion.

Differential associations of systolic and diastolic time rate of blood pressure variation with carotid atherosclerosis and plaque echogenicity.

In the current study, the authors sought to assess whether the time rate of systolic and diastolic blood pressure variation is associated with advanced subclinical stages of carotid atherosclerosis and plaque echogenicity assessed by gray scale median. The authors recruited 237 consecutive patients with normotension and hypertension who underwent 24-hour ambulatory blood pressure monitoring and carotid artery ultrasonography. There was an independent association between low 24-hour systolic time rate and increased echogenicity of carotid plaques (adjusted odds ratio for highest vs lower tertiles of gray scale median, 0.

A New Potent Inhibitor of Glycogen Phosphorylase Reveals the Basicity of the Catalytic Site.

The design and synthesis of a glucose-based acridone derivative (GLAC), a potent inhibitor of glycogen phosphorylase (GP) are described. GLAC is the first inhibitor of glycogen phosphorylase, the electronic absorption properties of which are clearly distinguishable from those of the enzyme. This allows probing subtle interactions in the catalytic site.

Ultrafast Fluorescence Dynamics in Flurbiprofen-Amino Acid Dyads and in the Supramolecular Drug/Protein Complex.

The interaction dynamics between the drug flurbiprofen (FBP) and human serum albumin (HSA) has been investigated by time-resolved fluorescence spectroscopy, combining femtosecond fluorescence upconversion and picosecond time-correlated single photon counting. In order to obtain additional information on the drug/ protein interaction, several covalently linked model dyads, composed of FBP and tryptophan or tyrosine, were also studied. For all systems, the main feature was a remarkable dynamic FBP fluorescence quenching, more prominent in the dyads than in the protein complex.

Xanthines Studied via Femtosecond Fluorescence Spectroscopy.

Xanthines represent a wide class of compounds closely related to the DNA bases adenine and guanine. Ubiquitous in the human body, they are capable of replacing natural bases in double helices and give rise to four-stranded structures. Although the use of their fluorescence for analytical purposes was proposed, their fluorescence properties have not been properly characterized so far.

High-Energy Long-Lived Mixed Frenkel-Charge-Transfer Excitons: From Double Stranded (AT)n to Natural DNA.

The electronic excited states populated upon absorption of UV photons by DNA are extensively studied in relation to the UV-induced damage to the genetic code. Here, we report a new unexpected relaxation pathway in adenine-thymine double-stranded structures (AT)n . Fluorescence measurements on (AT)n hairpins (six and ten base pairs) and duplexes (20 and 2000 base pairs) reveal the existence of an emission band peaking at approximately 320 nm and decaying on the nanosecond time scale.

Ultrafast Electron Transfer in Complexes of Doxorubicin with Human Telomeric G-Quadruplexes and GC Duplexes Probed by Femtosecond Fluorescence Spectroscopy.

Doxorubicin (DOX) is a natural anthracycline widely used in chemotherapy; its combined application as a chemotherapeutic and photodynamic agent has been recently proposed. In this context, understanding the photoinduced properties of DOX complexes with nucleic acids is crucial. Herein, the study of photoinduced electron transfer in DOX-DNA complexes by femtosecond fluorescence spectroscopy is reported.

Ultrafast Excited-State Deactivation of 8-Hydroxy-2'-deoxyguanosine Studied by Femtosecond Fluorescence Spectroscopy and Quantum-Chemical Calculations.

The fluorescence properties of the 8-hydroxy-2'-deoxyguanosine (8-oxo-dG) in aqueous solution at pH 6.5 are studied by steady-state spectroscopy and femtosecond fluorescence up-conversion and compared with those of 2'-deoxyguanine (dG) and 2'-deoxyguanine monophosphate (dGMP). The steady-state fluorescence spectrum of 8-oxo-dG is composed of a broad band that peaks at 356 nm and extends over the entire visible spectral region, and its fluorescence quantum yield is twice that of dG/dGMP.

Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study.

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K(+) cations, noted Tel21/K(+) . Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies.