A rho gene product in human blood platelets. II. Effects of the ADP-ribosylation by botulinum C3 ADP-ribosyltransferase on platelet aggregation.

In the accompanying paper (Nemoto, Y., Namba, T., Teru-uchi, T.

A rho gene product in human blood platelets. I. Identification of the platelet substrate for botulinum C3 ADP-ribosyltransferase as rhoA protein.

A substrate protein for botulinum C3 ADP-ribosyltransferase (C3 exoenzyme) in human platelets was purified to apparent homogeneity from the cytosol by ammonium sulfate fractionation and successive chromatography on columns of DEAE-Sepharose, hydroxylapatite, phenyl-Sepharose, and TSK phenyl-5PW. The purified protein yielded an amino acid sequence identical to that of rhoA protein. When platelet cytosol and membranes were incubated with C3 exoenzyme and [32P]NAD and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and isoelectric focusing, they gave only one [32P]ADP-ribosylated band on each electrophoresis that showed an M(r) of 22,000 and a pI of 6.

Purification and refolding of recombinant human IGF II from silkworms infected with recombinant Bombyx mori nuclear polyhedrosis virus.

We have reported that insulin-like growth factor II (IGF II) was produced as a fusion protein in Bombyx mori (silkworm) larval bodies infected with recombinant B. mori nuclear polyhedrosis virus [J. Gen.

Studies on the venom components of the long-glanded coral snake, Maticora bivirgata.

The venom of the Asian long-glanded coral snake, Maticora bivirgata, was fractionated into five fractions, S1-S5, by passing through a Sephadex G-50 column. Fraction S2 contains two phospholipases A2, PLA2 I and PLA2 II, fraction S3 contains four cytotoxin homologues, maticotoxins A, C, D1 and D2, and fractions S4 and S5 contain a large amount (about 1 mg/specimen) of adenosine accompanied with smaller amounts of inosine and guanosine. The amino-terminal amino acid sequences of PLA2, I, PLA2 II and maticotoxin A suggest that Maticora bivirgata is closely related to Bungarinae, especially to genera Hemachatus and Naja.

Presence and function of chondroitin-4-sulfate on recombinant human soluble thrombomodulin.

We constructed a human soluble thrombomodulin (sTM) expression vector using the RSV promoter. Recombinant sTM (rsTM) was expressed in CHO cells and was recovered from culture medium by ion exchange chromatography. Two active fractions, designated as rsTM alpha (low salt elution) and rsTM beta (high salt elution), were detected and further purified by immunoaffinity chromatography.

Nucleotide sequence analysis of a provirus derived from HTLV-1-associated myelopathy (HAM).

Human T-cell leukemia virus type 1 (HTLV-1) is known to be associated with adult T-cell leukemia (ATL). Recently, HTLV-1-associated myelopathy (HAM) was described as a neurological disease with which an etiological association of HTLV-1 is suspected. A provirus genome was cloned from a lymphoid cell line derived from the cerebrospinal fluid of a patient with HAM, in order to examine in detail the etiological virus associated with HAM.

Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored.