Mild-Temperature Catalyzed Hydrosilylation for Simplified Carbohydrate Functionalization of Porous Silicon Nanoparticles.

Porous silicon is one of the most explored nanostructured materials in various biomedical applications owing to its remarkable properties. However, its inherent chemical instability mandates a robust surface modification procedure, and proper surface bioengineering is essential to ensure its effectiveness in the biomedical field. In this study, we introduce a one-pot functionalization strategy that simultaneously stabilizes porous silicon nanoparticles and decorates their surface with carbohydrates through hydrosilylation chemistry, combining mild temperatures and a Lewis acid catalyst.

Engineering an oncolytic adenoviral platform for precise delivery of antisense peptide nucleic acid to modulate PD-L1 overexpression in cancer cells.

Cancer immunotherapy is focused on stimulating the immune system against cancer cells by exploiting immune checkpoint mechanisms. PD-1/PD-L1 is one of the most known immune checkpoints due to the widespread upregulation of the Programmed Death Ligand 1 (PD-L1) transmembrane protein in cancer tissues. Accordingly, taking advantage of the ability of oncolytic adenoviruses (OAd) to specifically infect and kill tumor cells over healthy ones, here, we developed a targeted delivery platform based on OAd to selectively deliver in cancer cells an antisense peptide nucleic acid (PNA) targeting the PD-L1 mRNA.

Circulating Multiple Myeloma Cells (CMMCs) as Prognostic and Predictive Markers in Multiple Myeloma and Smouldering MM Patients.

In recent years, liquid biopsy has emerged as a promising alternative to the bone marrow (BM) examination, since it is a minimally invasive technique allowing serial monitoring. Circulating multiple myeloma cells (CMMCs) enumerated using CELLSEARCH were correlated with patients' prognosis and measured under treatment to assess their role in monitoring disease dynamics. Forty-four MM and seven smouldering MM (SMM) patients were studied.

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin HTCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT) (Q), the 5'-5' stacked G4-dimer [d(CGGAGGT)] (Q), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')] (Q).

Polymorphism of G-quadruplexes formed by short oligonucleotides containing a 3'-3' inversion of polarity: From G:C:G:C tetrads to π-π stacked G-wires.

G-wires are supramolecular DNA structures based on the G-quadruplex (G4) structural motif obtained by the self-assembly of interlocked slipped G-rich oligonucleotide (ON) strands, or by end-to-end stacking of G4 units. Despite the increasing interest towards G-wires due to their potential applications in DNA nanotechnologies, the self-assembly process to obtain G-wires having a predefined length and stability is still neither completely understood nor controlled. In our previous studies, we demonstrated that the d(5'CG-3'-3'-GC5') ON, characterized by the presence of a 3'-3'-inversion of polarity site self-assembles into a G-wire structure when annealed in the presence of K ions.

Synthesis of Brominated Lactones Related to Mycalin A: Selective Antiproliferative Activity on Metastatic Melanoma Cells and Inhibition of the Cell Migration.

Starting from D-xylonolactone and D-ribonolactone, several five-membered bromolactones, related to the C1-C5 portion of mycalin A lactone, have been synthesized. The bromination of D-ribonolactone with HBr/AcOH, without a subsequent transesterification step, has been studied for the first time, giving us most of the acetylated lactones investigated in the present study. For each compound, where possible, both the C-3 alcohol and the corresponding acetate were prepared.

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry.

Microfluidic-Assisted Production of Gastro-Resistant Active-Targeted Diatomite Nanoparticles for the Local Release of Galunisertib in Metastatic Colorectal Cancer Cells.

The oral route is highly desirable for colorectal cancer (CRC) treatment because it allows concentrating the drug in the colon and achieving a localized effect. However, orally administered drugs are often metabolized in the liver, resulting in reduced efficacy and the need for higher doses. Nanoparticle-based drug delivery systems can be engineered to prevent the diffusion of the drug in the stomach, addressing the release at the target site, and enhancing the efficacy of the delivered drug.

Exploring the Relationship between G-Quadruplex Nucleic Acids and Plants: From Plant G-Quadruplex Function to Phytochemical G4 Ligands with Pharmaceutic Potential.

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies.

Development of Surface Chemical Strategies for Synthesizing Redox-Responsive Diatomite Nanoparticles as a Green Platform for On-Demand Intracellular Release of an Antisense Peptide Nucleic Acid Anticancer Agent.

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies.

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1'-uracilyl)-2-propanone on Serum Albumin Structure.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein.

Cytosine-rich oligonucleotides incorporating a non-nucleotide loop: A further step towards the obtainment of physiologically stable i-motif DNA.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(ACA) and d(C) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation.

Probing the Ca mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine.

Bioconjugation of Peptides to Hybrid Gold Nanoparticles.

Gold nanoparticles (AuNPs) can be produced by well-assessed synthesis methods and can show a high surface area-to-volume ratio, chemical inertness, high electron density, strong optical absorption as well as low toxicity. AuNPs have been conjugated with many different biomolecules for a wide range of biomedical applications. These applications require an increasingly complex level of surface decoration in order to achieve stability, efficacy, and specific functionalities.

SERS Quantification of Galunisertib Delivery in Colorectal Cancer Cells by Plasmonic-Assisted Diatomite Nanoparticles.

The small molecule Galunisertib (LY2157299, LY) shows multiple anticancer activities blocking the transforming growth factor-β1 receptor, responsible for the epithelial-to-mesenchymal transition (EMT) by which colorectal cancer (CRC) cells acquire migratory and metastatic capacities. However, frequent dosing of LY can produce highly toxic metabolites. Alternative strategies to reduce drug side effects can rely on nanoscale drug delivery systems that have led to a medical revolution in the treatment of cancer, improving drug efficacy and lowering drug toxicity.

PD-L1 Expression in Circulating Tumor Cells as a Promising Prognostic Biomarker in Advanced Non-small-cell Lung Cancer Treated with Immune Checkpoint Inhibitors.

Background: Circulating tumor cells (CTCs) are a promising source of biological information in cancer. Data correlating PD-L1 expression in CTCs with patients' response to immune checkpoint inhibitors (ICIs) in non-small-cell lung cancer (NSCLC) are still lacking.

Methods: This is a prospective single-center cohort study enrolling patients with advanced NSCLC.

Bioconjugation of a PNA Probe to Zinc Oxide Nanowires for Label-Free Sensing.

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis.

Porous Silicon Optical Devices: Recent Advances in Biosensing Applications.

This review summarizes the leading advancements in porous silicon (PSi) optical-biosensors, achieved over the past five years. The cost-effective fabrication process, the high internal surface area, the tunable pore size, and the photonic properties made the PSi an appealing transducing substrate for biosensing purposes, with applications in different research fields. Different optical PSi biosensors are reviewed and classified into four classes, based on the different biorecognition elements immobilized on the surface of the transducing material.

PNA-Based Graphene Oxide/Porous Silicon Hybrid Biosensor: Towards a Label-Free Optical Assay for Brugada Syndrome.

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS).

Time-gated luminescence imaging of positively charged poly-l-lysine-coated highly microporous silicon nanoparticles in living Hydra polyp.

The development of non-toxic fluorescent agents alternative to heavy metal-based semiconductor quantum dots represents a relevant topic in biomedical research and in particular in the bioimaging field. Herein, highly luminescent Si─H terminal microporous silicon nanoparticles with μs-lived photoemission are chemically modified with a two step process and successfully used as label-free probes for in vivo time-gated luminescence imaging. In this context, Hydra vulgaris is used as model organism for in vivo study and validity assessment.

Antiproliferative Activity of Mycalin A and Its Analogues on Human Skin Melanoma and Human Cervical Cancer Cells.

Mycalin A, a polybrominated C acetogenin isolated from the encrusting sponge , displays an antiproliferative activity on human melanoma (A375) and cervical adenocarcinoma (HeLa) cells and induces cell death by an apoptotic mechanism. Various analogues and degraded derivatives of the natural substance have been prepared. A modification of the left-hand part of the molecule generates the most active substances.

Probing the DNA Reactivity and the Anticancer Properties of a Novel Tubercidin-Pt(II) Complex.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium . In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin.

Porous Silicon-Based Aptasensors: The Next Generation of Label-Free Devices for Health Monitoring.

Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors.

In Vivo Toxicity Assessment of Hybrid Diatomite Nanovectors Using Hydra vulgaris as a Model System.

Drug nanocarriers based on nanostructured materials are very promising for precision and personalized medicine applications. Diatomite porous biosilica has been recently proposed as a novel and effective material in formulations of drug systems for oral and systemic delivery. In this paper, the cytotoxicity of hybrid diatomite silica functionalized nanovectors is assessed in vivo in a living model organism, the cnidarian freshwater polyp Hydra vulgaris.