Presence of divalent cation is not mandatory for the formation of intramolecular purine-motif triplex containing human c-jun protooncogene target.

Modulation of endogenous gene function, through sequence-specific recognition of double helical DNA via oligonucleotide-directed triplex formation, is a promising approach. Compared to the formation of pyrimidine motif triplexes, which require relatively low pH, purine motif appears to be the most gifted for their stability under physiological conditions. Our previous work has demonstrated formation of magnesium-ion dependent highly stable intermolecular triplexes using a purine third strand of varied lengths, at the purine•pyrimidine (Pu•Py) targets of SIV/HIV-2 (vpx) genes (Svinarchuk, F.

Post-translational modifications of histones H3 and H4 associated with the histone methyltransferases Suv39h1 and G9a.

Specific combinations of post-translational modifications of histones alter chromatin structure, facilitating gene transcription or silencing. Here we have investigated the 'histone code' associated with the histone methyltransferases Suv39h1 and G9a by combining double immunopurification and mass spectrometry. Our results confirm the previously reported histone modifications associated with Suv39h1 and G9a.

Molecular modeling of wild-type and D816V c-Kit inhibition based on ATP-competitive binding of ellipticine derivatives to tyrosine kinases.

The D816V activating mutation of the c-Kit kinase domain often causes human mastocytosis. Although inhibitors of wild-type c-Kit are known (e.g.

Differential signalling of NH2-terminal flag-labelled thrombopoietin receptor activated by TPO or anti-FLAG antibodies.

In this report, we compared activation of NH2-terminal FLAG-labelled thrombopoietin receptor (Mpl) by anti-FLAG antibodies and by thrombopoietin (TPO). We found that anti-FLAG monoclonal antibodies M1 dimerize FLAG-labelled receptor and trigger proliferation of BaF3/FLAG-Mpl cells. In UT7/FLAG-Mpl cells, activation of the FLAG-Mpl receptor by low TPO concentrations triggered proliferation, while high concentrations triggered differentiation.

A Role of Endogenous Retroviral MCF env Gene in Proliferation of Pluripotent Hemopoietic Progenitors in Mice.

We have investigated the role of endogenous retroviral mink cell focus-forming (MCF) genes in the regulation of mouse bone marrow hemopoietic progenitor cell proliferation. The p15E protein coded by the MCF env gene is expressed by early hemopoietic progenitors, mostly on spleen colony forming units (CFUs-12) and on erythropoietin-independent erythroid progenitors. Stimulation of cell proliferation in hemopoietic precursors by steroid hormone (testosterone propionate) treatment resulted in upregulation of the expression of the endogenous p15E protein on bone marrow cells.

Distinct effects of thrombopoietin depending on a threshold level of activated Mpl in BaF-3 cells.

Thrombopoietin (TPO) plays a critical role in megakaryopoiesis through binding to its receptor Mpl. This involves activation of various intracellular signaling pathways, including phosphoinositide 3-kinase (PI3K) and the mitogen-activated protein kinase (MAPK) pathways. Their precise role in TPO-mediated proliferation, survival and differentiation is not fully understood.

MplK, a natural variant of the thrombopoietin receptor with a truncated cytoplasmic domain, binds thrombopoietin but does not interfere with thrombopoietin-mediated cell growth.

Objective: Interaction of thrombopoietin (TPO) with its receptor c-Mpl is responsible for the formation of megakaryocytes and platelets. In humans, there are two major c-mpl molecules, MplP and MplK, which are generated by alternative splicing. In contrast to MplP, MplK has none of the intracellular sequences required for typical signal transduction but instead has a unique 27 amino acid sequence that is coded by intron 10.

The granulocyte colony-stimulating factor receptor supports erythroid differentiation in the absence of the erythropoietin receptor or Stat5.

To evaluate the functional conservation of signal transduction mechanisms between haematopoietic receptors and to characterize the molecules activated in this phenomenon, we introduced granulocyte colony-stimulating factor receptor (G-CSFR) cDNA into mouse fetal liver cells using a retroviral vector. In semi-solid medium assays, G-CSFR-infected cells gave rise to all types of colonies [granulocyte-macrophage (GM), megakaryocyte (MK) and mixed lineage (GEMM) colony-forming units (CFU) and erythroid burst-forming units (BFU-E)] in the presence of G-CSF alone. The direct effect of G-CSF on erythroid differentiation of G-CSFR-transduced erythroid progenitors was demonstrated by the development of erythroid colonies using G-CSFR-expressing Lin- cells cloned at one cell per well in liquid culture in the presence of G-CSF.

Gene activation by triplex-forming oligonucleotide coupled to the activating domain of protein VP16.

Triplex-forming oligonucleotides (TFOs) are generally designed to inhibit transcription or DNA replication but can be used for more diverse purposes. Here we have designed a chimera peptide-TFO able to activate transcription from a target gene. The designed hybrid molecule contains a triplex-forming sequence, linked through a phosphoroamidate bond to several minimal transcriptional activation domains derived from Herpes simplex virus protein 16 (VP16).

Stability of G,A triple helices.

In this work we selected double-stranded DNA sequences capable of forming stable triplexes at 20 or 50 degrees C with corresponding 13mer purine oligonucleotides. This selection was obtained by a double aptamer approach where both the starting sequences of the oligonucleotides and the target DNA duplex were random. The results of selection were confirmed by a cold exchange method and the influence of the position of a 'mismatch' on the stability of the triplex was documented in several cases.

Analysis of various sequence-specific triplexes by electron and atomic force microscopies.

Sequence-specific interactions of 20-mer G,A-containing triple helix-forming oligonucleotides (TFOs) and bis-PNAs (peptide nucleic acids) with double-stranded DNA was visualized by electron (EM) and atomic force (AFM) microscopies. Triplexes formed by biotinylated TFOs are easily detected by both EM and AFM in which streptavidin is a marker. AFM images of the unlabeled triplex within a long plasmid DNA show a approximately 0.

Recruitment of transcription factors to the target site by triplex-forming oligonucleotides.

Triplex-forming oligonucleotides (TFOs) are generally designed to inhibit transcription or DNA replication but can be used for more diverse purposes. Here we have designed a hairpin-TFO able to recruit transcription factors to a target DNA. The designed oligonucleotide contains a triplex-forming sequence, linked through a nucleotide loop to a double-stranded hairpin including the SRE enhancer of the c-fos gene promoter.

Investigation of the formation and intracellular stability of purine.(purine/pyrimidine) triplexes.

In a previous work we showed that a short triple helix-forming oligonucleotide (TFO) targeted to the murine c-pim-1 proto-oncogene promoter gives a very stable triple helix under physiological conditions in vitro . Moreover, this triplex was stable inside cells when preformed in vitro . However, we failed to detect triplex formation for this sequence inside cells in DMS footprinting studies.

A new approach to overcome potassium-mediated inhibition of triplex formation.

G,A-containing purine oligonucleotides of various lengths form extremely stable and specific triplexes with the purine-pyrimidine stretch of the vpx gene [Svinarchuk,F., Monnot,M., Merle,A.

Investigation of the intracellular stability and formation of a triple helix formed with a short purine oligonucleotide targeted to the murine c-pim-1 proto-oncogene promotor.

In our previous work we have shown that the oligonucleotide 5'-GGGGAGGGGGAGG-3' gives a very stable and specific triplex with the promoter of the murine c-pim-1 proto-oncogene in vitro[Svinarchuk, F., Bertrand, J.-R.

The high stability of the triple helices formed between short purine oligonucleotides and SIV/HIV-2 vpx genes is determined by the targeted DNA structure.

In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R.

An unusually stable purine(purine-pyrimidine) short triplex. The third strand stabilizes double-stranded DNA.

Classical models for DNA triple helix formation assume the stabilization of these structures through the formation of Hoogsteen hydrogen bonds. This assumes that G-rich duplex DNA is more stable than triplex DNA. We report the results of co-migration assay, dimethyl sulfate footprint, and UV spectroscopic melting studies that reveal that at least in some cases of short (13-mer) purine(purine-pyrimidine) triplex the stability of double-stranded DNA is increased by the binding of the third strand.

[Functional activity of T-, B-lymphocytes, and macrophages during suppression of expression of the env gene from an endogenous retrovirus genome].

Incubation of murine spleen cells with antisense oligonucleotide complementary to initiation site of this gene highly increased RNA synthesis relative to the normal T- and B-lymphocytes from spleen. In macrophages, inhibition of gene env expression stimulated phagocytosis and IL-1 production. Under these conditions, the level of expression of proviral envelope transmembrane p15E protein, which in infectious type C retroviruses is known to be immunosuppressive, decreased in spleen cells.

Gene-targeted inhibition of transactivation of human immunodeficiency virus type-1 (HIV-1)-LTR by antisense oligonucleotides.

We have used an in vitro approach to study the efficiency of antisense oligonucleotides in inhibiting LTR-(HIV-1)-directed CAT expression catalyzed by tat protein, the functional protein of the transactivator gene. We selected the target sequence localized near the 5' end of the tat mRNA. The following conclusions can be drawn from the data presented here: a) Antisense oligonucleotides modified by conjugation of cholesterol at the 3' end have a severalfold higher inhibitory response, b) inhibitory response is dependent on the mode of introducing oligonucleotides, and c) the inhibition by antisense oligonucleotides is sequence specific and directed towards the targeted region.

A short purine oligonucleotide forms a highly stable triple helix with the promoter of the murine c-pim-1 proto-oncogene.

A homopurine-homopyrimidine region of murine c-pim-1 proto-oncogene was chosen as a target for triple-helix-forming oligonucleotide. Oligonucleotide 5'-GGG-GAGGGGGAGG-3' was shown to bind to its target sequence in the presence of 50 mM Na+ or K+, 10 mM MgCl2 and 20 mM Tris-acetate, pH 7.5.

Antisense oligonucleotide complementary to endogenous retroviral MCF env gene inhibits both BFU-E and CFU-S colony formation in mice.

A possible biologic activity of endogenously expressed env sequence of retroviral mink cell focus-forming virus (MCF) genome for hematopoietic colony formation was studied in mice. Antisense 20-mer complementary to MCF env sequence was used to detect the result of blockage of this gene translation on the potency of marrow cells to form colonies of erythroid (BFU-E), myeloid granulocyte-macrophage (CFU-GM), and stem cell (day 11 CFU-S) hematopoietic compartments. A large relative decrease in BFU-E number was found in bone marrow cell cultures preincubated with antisense oligonucleotide during 4 h, whereas CFU-GM colonies remained unaffected.

[Binding of nuclear proteins with segments of the c-fos gene promotor, localized in position (-465)-(-435) correlates with cell proliferation].

Using gel-retardation assay we have investigated binding of nuclear proteins to the mouse c-fos promoter region 30 b.p. long (nucleotides (-464) - (-435) from TATA-box), localized upstream of PDGF-dependent induction element.

[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides].

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.

[Nuclear peptides, specifically binding oligonucleotides].

Interaction of alkylating derivatives of oligonucleotides with nuclear extracts from mammalian cells has been investigated. Three modified 1.5-, 3.