Harbingers of Hope: Scientists and the Pursuit of World Peace.

The ongoing wars in many regions-such as the conflict between Israel and Hamas-as well as the effects of war on communities, social services, and mental health are covered in this special editorial. This article emphasizes the need for international efforts to promote peace, offer humanitarian aid, and address the mental health challenges faced by individuals and communities affected by war and violence.

Draft Genome Sequence of the Earthworm .

Earthworms are annelids. They play a major role in agriculture and soil fertility. Vermicompost is the best organic manure for plant crops.

Preliminary investigation on the impact of engineered PVP-capped and uncapped silver nanoparticles on Eudrilus eugeniae, a terrestrial ecosystem model.

Recently, the production of silver nanoparticles and their commercial products has generated increased concern and caused a hazardous impact on the ecosystem. Therefore, the present study examines the toxic effect of chemically engineered silver nanoparticles (SNPs) and polyvinylpyrrolidone-capped silver nanoparticles (PVP-SNPs) on the earthworm Eudrilus eugeniae (E. eugeniae).

Importance of clitellar tissue in the regeneration ability of earthworm Eudrilus eugeniae.

Among the annelids, earthworms are renowned for their phenomenal ability to regenerate the lost segments. The adult earthworm Eudrilus eugeniae contains 120 segments and the body segments of the earthworm are divided into pre-clitellar, clitellar and post-clitellar segments. The present study denoted that clitellum plays vital role in the successful regeneration of the species.

Identification, tissue specific expression analysis and functional characterization of arrestin gene (ARRDC) in the earthworm Eudrilus eugeniae: a molecular hypothesis behind worm photoreception.

Background: The arrestin domain containing proteins (ARRDCs) are crucial adaptor proteins assist in signal transduction and regulation of sensory physiology. The molecular localization of the ARRDC gene has been confined mainly to the mammalian system while in invertebrates the expression pattern was not addressed significantly. The present study reports the identification, tissue specific expression and functional characterization of an ARRDC transcript in earthworm, Eudrilus eugeniae.

Advances in targeting the WNT/β-catenin signaling pathway in cancer.

WNT/β-catenin signaling orchestrates various physiological processes, including embryonic development, growth, tissue homeostasis, and regeneration. Abnormal WNT/β-catenin signaling is associated with various cancers and its inhibition has shown effective antitumor responses. In this review, we discuss the pathway, potential targets for the development of WNT/β-catenin inhibitors, available inhibitors, and their specific molecular interactions with the target proteins.

The transcriptome of anterior regeneration in earthworm Eudrilus eugeniae.

The oligochaete earthworm, Eudrilus eugeniae is capable of regenerating both anterior and posterior segments. The present study focuses on the transcriptome analysis of earthworm E. eugeniae to identify and functionally annotate the key genes supporting the anterior blastema formation and regulating the anterior regeneration of the worm.

Finding of novel telomeric repeats and their distribution in the human genome.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG.

Earthworms and vermicompost: an eco-friendly approach for repaying nature's debt.

The steady increase in the world's population has intensified the need for crop productivity, but the majority of the agricultural practices are associated with adverse effects on the environment. Such undesired environmental outcomes may be mitigated by utilizing biological agents as part of farming practice. The present review article summarizes the analyses of the current status of global agriculture and soil scenarios; a description of the role of earthworms and their products as better biofertilizer; and suggestions for the rejuvenation of such technology despite significant lapses and gaps in research and extension programs.

Draft Genome Sequence of Escherichia coli Phage CMSTMSU, Isolated from Shrimp Farm Effluent Water.

The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa.

Data on genome annotation and analysis of earthworm .

The present article reports the complete draft genome annotation of earthworm , obtained from the manuscript entitled "Timing and Scope of Genomic Expansion within Annelida: Evidence from Homeoboxes in the Genome of the Earthworm " (Zwarycz et al., 2015) and provides the data on the repetitive elements, protein coding genes and noncoding RNAs present in the genome dataset of the species. The protein coding genes were predicted from AUGUSTUS gene prediction and subsequently annotated based on their sequence similarity, Gene Ontology (GO) functional terms, InterPro domains, Clusters of Orthologous Groups (COGs) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways information.

Data on genome sequencing, analysis and annotation of a pathogenic 062011msu.

species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production.

Exploiting the unique phenotypes of the earthworm Eudrilus eugeniae to evaluate the toxicity of chemical substances.

Both the evaluation and the determination of toxicity of chemical substances present in the environment have implications in human health. In this present study, the natural phenomenon named autotomy, a self-defense mechanism employed by several animals against the toxic chemical contaminants, was considered to assess the toxicity of different chemical substances. We investigated the effects of glucose, sodium chloride, kanamycin, mercuric chloride, arsenic trioxide, and lead oxide on the phenotypes of earthworm Eudrilus eugeniae.

Annotation of nerve cord transcriptome in earthworm .

In annelid worms, the nerve cord serves as a crucial organ to control the sensory and behavioral physiology. The inadequate genome resource of earthworms has prioritized the comprehensive analysis of their transcriptome dataset to monitor the genes express in the nerve cord and predict their role in the neurotransmission and sensory perception of the species. The present study focuses on identifying the potential transcripts and predicting their functional features by annotating the transcriptome dataset of nerve cord tissues prepared by Gong et al.

Function of translationally controlled tumor protein (TCTP) in Eudrilus eugeniae regeneration.

TCTP (Translationally Controlled Tumour Protein) is a multifunctional protein that plays a role in the development, immune system, tumour reversion, and maintenance of stem cells. The mRNA of the Tpt1 gene is over-expressed during liver regeneration. But, the function of the protein in regeneration is not known.

Studies on regeneration of central nervous system and social ability of the earthworm Eudrilus eugeniae.

Earthworms are segmented invertebrates that belong to the phylum Annelida. The segments can be divided into the anterior, clitellar and posterior parts. If the anterior part of the earthworm, which includes the brain, is amputated, the worm would essentially survive even in the absence of the brain.

Identification of shorter length lamin A protein in mouse ear cartilage tissue.

Lamin A is an intermediate filament protein which is cleaved by the enzyme, FACE 1 at VTRSY↓L. The cleavage is the final step in the production of the mature lamin A protein. The mature lamin A protein localizes in the inner membrane of the nucleus.

Conserved lamin A protein expression in differentiated cells in the earthworm Eudrilus eugeniae.

Lamin A is an intermediate filament protein found in most of the differentiated vertebrate cells but absent in stem cells. It shapes the skeletal frame structure beneath the inner nuclear membrane of the cell nucleus. As there are few studies of the expression of lamin A in invertebrates, in the present work, we have analyzed the sequence, immunochemical conservation and expression pattern of lamin A protein in the earthworm Eudrilus eugeniae, a model organism for tissue regeneration.

Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C.

Unique phenotypes in the sperm of the earthworm Eudrilus eugeniae for assessing radiation hazards.

The earthworm, Eudrilus eugeniae is a segmented worm. It has two pairs of testes whose cells are highly proliferative. It was found that the earthworm, which is irradiated with X-ray, shows the following phenotypic changes in its sperm: fragmented acrosome in the head, break in the tail, and the appearance of zigzag sperm tail.

Cep164 is a mediator protein required for the maintenance of genomic stability through modulation of MDC1, RPA, and CHK1.

The activation of the ataxia telangiectasia mutated (ATM) and ATM/Rad3-related (ATR) kinases triggers a diverse cellular response including the initiation of DNA damage-induced cell cycle checkpoints. Mediator of DNA Damage Checkpoint protein, MDC1, and H2AX are chromatin remodeling factors required for the recruitment of DNA repair proteins to the DNA damage sites. We identified a novel mediator protein, Cep164 (KIAA1052), that interacts with both ATR and ATM.