The VECELL 3-D insert is a new culture scaffold consisting of collagen-coated ePTFE (expanded polytetrafluoroethylene) mesh. We analyzed the effects of VECELL 3-D inserts on the functionality of HepG2, a human hepatocellular carcinoma cell line. HepG2 cells cultured on VECELL 3-D inserts maintained a round shape, while those cultured on a standard culture plate or collagen-coated cell culture plate showed a flattened and cubic epithelial-like shape.
View Article and Find Full Text PDFThe liver is the central organ of metabolism, but its function varies during development from fetus to adult. In this study, we comprehensively analyzed and compared metabolites in fetal and adult hepatocytes, the major parenchymal cell in the liver, from human donors. We identified 211 metabolites (116 anions and 95 cations) by capillary electrophoresis-time-of-flight mass spectrometry (CE-TOFMS) in the hepatocytes cultured in vitro.
View Article and Find Full Text PDFCYP3A4, the major form of cytochrome P450 (P450) expressed in the adult human liver, is involved in the metabolism of approximately 50% of commonly prescribed drugs. Several genetic polymorphisms in CYP3A4 are known to affect its catalytic activity and to contribute in part to interindividual differences in the pharmacokinetics and pharmacodynamics of CYP3A4 substrate drugs. In this study, catalytic activities of the two alleles found in East Asians, CYP3A4*16 (T185S) and CYP3A4*18 (L293P), were assessed using the following seven substrates: midazolam, carbamazepine, atorvastatin, paclitaxel, docetaxel, irinotecan, and terfenadine.
View Article and Find Full Text PDFBackground And Objective: Gemcitabine (2',2'-difluorodeoxycytidine) is an anticancer drug, which is effective against solid tumours, including non-small-cell lung cancer and pancreatic cancer. After gemcitabine is transported into cells by equilibrative and concentrative nucleoside transporters, it is phosphorylated by deoxycytidine kinase (DCK) and further phosphorylated to its active diphosphorylated and triphosphorylated forms. Gemcitabine is rapidly metabolized by cytidine deaminase (CDA) to an inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), which is excreted into the urine.
View Article and Find Full Text PDFDrug Metab Pharmacokinet
April 2010
Cytidine deaminase, encoded by the CDA gene, catalyzes anti-cancer drugs gemcitabine and ara-C into their respective inactive metabolites. In CDA, two functionally significant non-synonymous polymorphisms, 79A>C (Lys27Gln) and 208G>A (Ala70Thr), have been found and their minor allele frequencies (MAFs) were reported in Japanese and Chinese patients and a relatively small numbers of healthy volunteers in Caucasians and Africans. In this study, we determined the MAFs of both polymorphisms in 200 healthy volunteers of Koreans, along with 206 Japanese, 200 Chinese-Americans, 150 Caucasian-Americans and 150 African-Americans to reveal ethnic differences.
View Article and Find Full Text PDFPurpose: Effects of genetic polymorphisms/variations of ABCB1, ABCC2, ABCG2 and SLCO1B1 in addition to "UGT1A1*28 or *6" on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients were investigated.
Methods: Associations between transporter haplotypes/variations along with UGT1A1*28 or *6 and SN-38 area under the time-concentration curve (AUC) or neutropenia were examined in irinotecan monotherapy (55 patients) and irinotecan-cisplatin-combination therapy (62 patients).
Results: Higher SN-38 AUC values were observed in ABCB1 2677G>T (A893S) (*2 group) for both regimens.
The bile salt export pump (BSEP) encoded by ABCB11 is located in the canalicular membrane of hepatocytes and mediates the secretion of numerous conjugated bile salts into the bile canaliculus. In this study, 28 ABCB11 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 120 Japanese subjects. Fifty-nine genetic variations, including 19 novel ones, were found: 14 in the coding exons (6 nonsynonymous and 8 synonymous variations), 4 in the 3'-UTR, and 41 in the introns.
View Article and Find Full Text PDFCYP2C9 is a polymorphic enzyme that metabolizes a number of clinically important drugs. In this study, catalytic activities of seven alleles found in Japanese individuals, CYP2C9*3 (I359L), *13 (L90P), *26 (T130R), *28 (Q214L), *30 (A477T), *33 (R132Q), and *34 (R335Q), were assessed using three substrates (diclofenac, losartan, and glimepiride). When expressed in a baculovirus-insect cell system, the holo and total (apo and holo) CYP2C9 protein expression levels were similar among the wild type (CYP2C9.
View Article and Find Full Text PDFDeoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns.
View Article and Find Full Text PDFA liver-specific transporter organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C) is encoded by SLCO1B1 and mediates uptake of various endogenous and exogenous compounds from blood into hepatocytes. In this study, 15 SLCO1B1 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 177 Japanese subjects. Sixty-two genetic variations, including 28 novel ones, were found: 7 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 5 in the 3'-UTR, and 36 in the introns.
View Article and Find Full Text PDFHuman carboxylesterase 2 (hCE-2) is a member of the serine esterase superfamily and is responsible for hydrolysis of a wide variety of xenobiotic and endogenous esters. hCE-2 also activates an anticancer drug, irinotecan (7-ethyl-10-[4-(1-piperidino)-1-piperidino]-carbonyloxycamptothecin, CPT-11), into its active metabolite, 7-ethyl-10-hydroxycamptothecin (SN-38). In this study, a comprehensive haplotype analysis of the CES2 gene, which encodes hCE-2, in a Japanese population was conducted.
View Article and Find Full Text PDFObjective: CYP2C8 is known to metabolize various drugs including an anticancer drug paclitaxel. Although large interindividual differences in CYP2C8 enzymatic activity and several nonsynonymous variations were reported, neither haplotype structures nor their associations with pharmacokinetic parameters of paclitaxel were reported.
Methods: Haplotype structures of the CYP2C8 gene were inferred by an expectation-maximization based program using 40 genetic variations detected in 437 Japanese patients, which included cancer patients.
Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.
View Article and Find Full Text PDFPurpose: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities.
View Article and Find Full Text PDFThirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.
View Article and Find Full Text PDFChromosome DNA is continuously exposed to various endogenous and exogenous mutagens. Among them, oxidation is one of the most common threats to genetic stability, and multiple DNA repair enzymes protect chromosome DNA from the oxidative damage. In Escherichia coli, three repair enzymes synergistically reduce the mutagenicity of oxidized base 8-hydroxy-guanine (8-OH-G).
View Article and Find Full Text PDFTwelve single nucleotide polymorphisms (SNPs) in the human CES2 gene, which encodes a carboxylesterase, hCE-2 [human carboxylesterase 2 (EC 3.1.1.
View Article and Find Full Text PDFPurpose: Thymidylate synthase (TS) is one of the target molecules for the antitumor effects of fluoropyrimidine drugs. The cellular thymidylate synthase level is one of the determining factors for the antitumor activity of fluoropyrimidines. TYMS, which encodes TS, has been reported to possess 28-bp tandem repeat sequences in its 5'-untranslated region, the number of which varies.
View Article and Find Full Text PDFEnviron Mol Mutagen
October 2005
Benzo[a]pyrene (B[a]P) is an environmental carcinogenic polycyclic aromatic hydrocarbon (PAH). Mammalian enzymes such as cytochrome P-450s and epoxide hydrase convert B[a]P to reactive metabolites that can covalently bind to DNA. However, some carcinogenic compounds that normally require metabolic activation can also be directly photoactivated to mutagens.
View Article and Find Full Text PDFPurpose: We investigated single-nucleotide polymorphisms of the cytidine deaminase gene (CDA), which encodes an enzyme that metabolizes gemcitabine, to clarify the relationship between the single-nucleotide polymorphism 208G>A and the pharmacokinetics and toxicity of gemcitabine in cancer patients treated with gemcitabine plus cisplatin.
Experimental Design: Six Japanese cancer patients treated with gemcitabine plus cisplatin were examined. Plasma gemcitabine and its metabolite 2',2'-difluorodeoxyuridine were measured using an high-performance liquid chromatography method, and the CDA genotypes were determined with DNA sequencing.
Twelve novel single nucleotide polymorphisms (SNPs) were found in the CES2 gene from 153 Japanese individuals, who were administered irinotecan or steroidal drugs. The detected SNPs were as follows:1) SNP, MPJ6_CS2001; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-CTGGAACAACTCG/CCTCCCCTCGGAA-3'.
View Article and Find Full Text PDF8-Hydroxyguanine (8-OH-G) is an oxidatively damaged guanine base that causes G:C to T:A transversion mutations. To counteract the mutagenicity of 8-OH-G in DNA, humans possess the hOGG1 gene, which encodes 8-OH-G DNA glycosylase. Interestingly, genetic polymorphisms at codon 326 (hOGG1-Ser326 versus hOGG1-Cys326) and at codon 46 (hOGG1-Arg46 versus hOGG1-Gln46) exist in human populations.
View Article and Find Full Text PDFIn order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified.
View Article and Find Full Text PDFDeranged oxidative metabolism is a property of many tumour cells. Oxidation of the deoxynucleotide triphosphate (dNTP) pool, as well as DNA, is a major cause of genome instability. Here, we report that two Y-family DNA polymerases of the archaeon Sulfolobus solfataricus strains P1 and P2 incorporate oxidized dNTPs into nascent DNA in an erroneous manner: the polymerases exclusively incorporate 8-OH-dGTP opposite adenine in the template, and incorporate 2-OH-dATP opposite guanine more efficiently than opposite thymine.
View Article and Find Full Text PDF