[Synthesis and functional activity of initiation regions of mRNA translation. II. RNA-ligase synthesis of hepta- and decaribonucleotides--components of 20-base polyribonucleotide templates].

Preparative RNA-ligase synthesis of decaribonucleotides, the 5'-and 3'-constituent parts to be used for the synthesis of 20-base polyribonucleotides] simulating minimal translation initiation regions for phage RNA was carried out. The decamers were obtained via appropriate heptamers also by RNA-ligase catalyzed synthesis. Apart from decamers used to prepare the functionally active 20-base polyribonucleotide, the minimal translation initiation region of the replicase gene (R) in MS2 and fr phage--sequence R(-17----3) and two its variants, decanucleotides for other template modification were also synthesized.

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr.

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments.