Metformin attenuates pressure overload-induced cardiac hypertrophy via AMPK activation.

Aim: To identify the role of metformin in cardiac hypertrophy and investigate the possible mechanism underlying this effect.

Methods: Wild type and AMPKα2 knockout (AMPKα2⁻/⁻) littermates were subjected to left ventricular pressure overload caused by transverse aortic constriction. After administration of metformin (200 mg·kg⁻¹·d⁻¹) for 6 weeks, the degree of cardiac hypertrophy was evaluated using echocardiography and anatomic and histological methods.

A distinct AMP-activated protein kinase phosphorylation site characterizes cardiac hypertrophy induced by L-thyroxine and angiotensin II.

1. The purpose of the present study was to evaluate differences in the AMP-activated protein kinase (AMPK) phosphorylation sites in cardiac hypertrophy induced by L-thyroxine and angiotensin (Ang) II. 2.

[Role of GATA-4 in cardiac development and remodeling].

GATA-4 plays important roles in the process of cardiac development and remodeling. Deletion or mutation of GATA-4 is associated with malformation of cardiac development directly, even embryolethality. Down-regulation of GATA-4 may lead to deterioration of cardiac function.

[A case-control study of factors associated with primary angle-closure glaucoma].

Objective: To understand the risk factors of primary angle-closure glaucoma.

Methods: One to one matched case-control study was conducted in this study. One hundred and ninety two PACG cases and 192 controls, matched by age and gender, were collected from Department of Ophthalmology, Affiliated Hospital of Nantong University.

[Construction of eukaryotic expression plasmids with paramyosin gene of periodic Brugia malayi].

Total RNA was extracted from periodic Brugia malayi Specific primers were designed on the basis of known sequences of paramyosin gene from B. malayi (BmPmy). The desired gene was amplified by PCR technique from cDNA.

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D.