Association between cerebral microbleeds and cognitive function: a systematic review.

Background: Cerebral microbleeds (MBs), defined as haemorrhagic microvascular lesions or microangiopathy in the brain, have traditionally been considered clinically silent. Recent studies, however, suggest that MBs are associated with a decline in cognitive function.

Objective: To determine whether an association between MBs and cognitive function exists, we conducted a systematic review of the literature using the Cochrane Library, MEDLINE, EMBASE and the China National Knowledge Infrastructure database.

Identification of a novel phenolic compound in litchi (Litchi chinensis Sonn.) pericarp and bioactivity evaluation.

Litchi (Litchi chinensis Sonn.) is a delicious fruit widely accepted by consumers all over the world. In this work, phytochemical investigation of litchi pericarp methanol extracts led to the isolation of a novel phenolic, 2-(2-hydroxyl-5-(methoxycarbonyl) phenoxy) benzoic acid, together with kaempferol, isolariciresinol, stigmasterol, butylated hydroxytoluene, 3,4-dihydroxyl benzoate, methyl shikimate and ethyl shikimate.

A cohort study of patients with anemia on admission and fatality after acute ischemic stroke.

Reduced blood hemoglobin levels may impair oxygen delivery to the brain and hinder neurological improvement. We prospectively registered consecutively hospitalized Chinese patients with acute ischemic stroke within 24 hours of symptom onset to investigate whether anemia on admission influences case fatality and functional outcome of acute ischemic stroke at 12 months. Anemia was defined as a blood hemoglobin level of < 120 g/L for women, and < 130 g/L for men.

Optimal time-point for neural stem cell transplantation to delay denervated skeletal muscle atrophy.

Introduction: Transplantation of neural stem cells (NSCs) is a promising treatment to delay denervated skeletal muscle atrophy; however, the optimal time-point between peripheral nerve injury and NSC transplantation needs to be determined.

Methods: Improvement in rat gastrocnemius muscle function was evaluated after NSCs were transplanted into sectioned distal tibial nerves. We also assessed survival and differentiation.

Enhanced DPPH radical scavenging activity and DNA protection effect of litchi pericarp extract by Aspergillus awamori bioconversion.

Background: Litchi (Litchi chinensis Sonn.) pericarp is a major byproduct which contains a significant amount of polyphenol. This study was designed to biotransformation litchi pericarp extract (LPE) by Aspergillus awamori to produce more bioactive compounds with stronger antioxidant activities.

Features of acute ischemic stroke with rheumatic heart disease in a hospitalized Chinese population.

Background And Purpose: Rheumatic heart disease (RHD) is an important risk factor for ischemic stroke in developing countries. Observational data on its characteristics and influence on outcome or recurrence of ischemic stroke are scarce. We aimed to investigate proportions, characteristics, functional outcome, and recurrence of acute ischemic stroke patients with RHD in a hospitalized Chinese population.

Expression profiling of Rab GTPases reveals the involvement of Rab20 and Rab32 in acute brain inflammation in mice.

Rab GTPases have emerged as central regulators of vesicle trafficking and are essential for cytokine production during the pathogenesis of neuroinflammation. To characterize the roles of different Rab proteins in brain inflammation, we used quantitative PCR (qPCR) to examine the expression profiles of all members of the Rab family in an experimental model of brain inflammation in mice. We found that Rab20 and Rab32 were substantially up-regulated during the acute phase of inflammation.

Molecular evolution of psbA gene in ferns: unraveling selective pressure and co-evolutionary pattern.

Background: The photosynthetic oxygen-evolving photo system II (PS II) produces almost the entire oxygen in the atmosphere. This unique biochemical system comprises a functional core complex that is encoded by psbA and other genes. Unraveling the evolutionary dynamics of this gene is of particular interest owing to its direct role in oxygen production.

Investigation of non-covalent interaction of natural flexible cyclic molecules with telomeric RNA G-quadruplexes by electrospray ionization mass spectrometry.

Rationale: Recently, human telomeric DNA was found to be transcribed into RNA transcripts composing of tandem repeats of r(UUAGGG) which can form G-quadruplex structures. Studies have shown that human telomeric RNA is associated with the telomerase activity in vitro. Finding high affinity small molecule ligands binding to the telomeric RNA G-quadruplex may facilitate the regulation of the telomerase activity.

[Investigation of occupational hazards of ultraviolet radiation and protective measures for workers in electric welding].

Objective: To investigate and analyze the occupational hazards of ultraviolet radiation, protective measures and related factors for typical symptoms among workers in electric welding, and to provide basic information for revision of the occupational standards of UV.

Methods: Questionnaires and physical examinations were used in this investigation. A total of 828 workers from four vehicle manufacturers in Beijing and Guangdong Province were selected.

Posterior versus anterior circulation infarction: how different are the neurological deficits?

Background And Purpose: Distinguishing between symptoms of posterior circulation infarction (PCI) and anterior circulation infarction (ACI) can be challenging. This study evaluated the frequency of symptoms/signs in the 2 vascular territories to determine the diagnostic value of particular symptoms/signs for PCI.

Methods: Neurological deficits were reviewed and compared from 1174 consecutive patients with a diagnosis of PCI or ACI confirmed by magnetic resonance imaging in the Chengdu Stroke Registry.

Up-regulating relaxin expression by G-quadruplex interactive ligand to achieve antifibrotic action.

Myocardial fibrosis is a key pathological change in a variety of heart diseases contributing to the development of heart failure, arrhythmias, and sudden death. Recent studies have shown that relaxin prevents and reverses cardiac fibrosis. Endogenous expression of relaxin was elevated in the setting of heart disease; the extent of such up-regulation, however, is insufficient to exert compensatory actions, and the mechanism regulating relaxin expression is poorly defined.

Gonadectomy differentially regulates steroid receptor coactivator-1 and synaptic proteins in the hippocampus of adult female and male C57BL/6 mice.

Hippocampus is one of the most important structures that mediates learning and memory, cognition, and mental behaviors and profoundly regulated by sex hormones in a sex-specific manner, but the mechanism of underlying sex differences regulation is still unclear. We have previously reported that in the male and female mice, steroid receptor coactivator-1 (SRC-1) and some key synaptic proteins share similar developmental profile in the hippocampus, but how circulating sex hormones affect hippocampal SRC-1 as well as these synaptic proteins remain unclear. In this study, we examined how gonad sex hormones regulate hippocampal SRC-1, synaptophysin, PSD-95, and AMPA receptor subtype GluR1 by using immunohistochemistry and Western blot.

Fibrinogen depleting agents for acute ischaemic stroke.

Background: Fibrinogen depleting agents reduce fibrinogen in blood plasma, reduce blood viscosity and hence increase blood flow. This may help remove the blood clot blocking the artery and re-establish blood flow to the affected area of the brain after an ischaemic stroke. The risk of haemorrhage may be less than with thrombolytic agents.

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products.

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities.

Heme activates TLR4-mediated inflammatory injury via MyD88/TRIF signaling pathway in intracerebral hemorrhage.

Background: Inflammatory injury plays a critical role in intracerebral hemorrhage (ICH)-induced neurological deficits; however, the signaling pathways are not apparent by which the upstream cellular events trigger innate immune and inflammatory responses that contribute to neurological impairments. Toll-like receptor 4 (TLR4) plays a role in inflammatory damage caused by brain disorders.

Methods: In this study, we investigate the role of TLR4 signaling in ICH-induced inflammation.

The formation and stabilization of a novel G-quadruplex in the 5'-flanking region of the relaxin gene.

It has been reported that binding of STAT3 protein to the 5'-flanking region of the relaxin gene may result in downregulation of the relaxin expression. There is a Guanine(G)-rich segment located in about 3.8 Kb upstream of the relaxin gene and very close to the STAT3's binding site.

Microglial TIR-domain-containing adapter-inducing interferon-β (TRIF) deficiency promotes retinal ganglion cell survival and axon regeneration via nuclear factor-κB.

Background: TIR-domain-containing adapter-inducing interferon-β (TRIF) is the sole downstream adaptor of Toll-like receptor (TLR)3, which is one of the major signaling pathways in immune cells leading to neuroinflammation in the central nervous system. Overexpression of TRIF may lead to activation of inflammatory responses, and contribute to pathophysiological progression in both acute and chronic neurodegenerative retinal diseases. In the present study, was aimed to elucidate the contributions of TRIF to optic nerve (ON) regeneration and retinal ganglion cell (RGC) survival following injury to the ON, a widely studied model of central nervous system injury and of degenerative diseases such as glaucoma.

External counterpulsation for acute ischaemic stroke.

Background: External counterpulsation (ECP) may improve cerebral blood flow, and it has been proposed as a potential therapy for patients with ischaemic stroke.

Objectives: To assess the efficacy and safety of ECP for acute ischaemic stroke.

Search Methods: We searched the Cochrane Stroke Group Trials Register (June 2011), Cochrane Central Register of Controlled Trials (CENTRAL) (The Cochrane Library, 2011 Issue 2), MEDLINE (1948 to June 2011), EMBASE (1980 to June 2011), CINAHL (1982 to June 2011), AMED (Allied and Complementary Medicine) (1985 to June 2011), China Biological Medicine Database (CBM) (1978 to June 2011), Chinese National Knowledge Infrastructure (CNKI) (1979 to June 2011), Chinese Science and Technique Journals Database (VIP) (1989 to June 2011) and Wanfang Data (1984 to June 2011).

A luminescent bacterium assay of fusaric acid produced by Fusarium proliferatum from banana.

Fusarium proliferatum was isolated as a major pathogen causing the Fusarium disease in harvested banana fruit. One of its major compounds, fusaric acid, was identified by high-performance liquid chromatography-electrospray ionization mass spectrometry (HPLC-ESI-MS). Because the light intensity of the luminescent bacterium Vibrio qinghaiensis sp.

Toll-like receptors in cerebral ischemic inflammatory injury.

Cerebral ischemia triggers acute inflammation, which has been associated with an increase in brain damage. The mechanisms that regulate the inflammatory response after cerebral ischemia are multifaceted. An important component of this response is the activation of the innate immune system.

Formation, recognition and bioactivities of a novel G-quadruplex in the STAT3 gene.

G-Quadruplexes have been proved to exist in 5'-untranslated region (5'-UTR), promoter, intron and exon regions of many human genes. Here we report an intramolecular G-quadruplex formed by a G-rich sequence in the 3'-flanking region of signal transducers and activators of transcription 3 (STAT3) gene. The results showed that this G-rich sequence could affect the expression of STAT3.

[Heavy metals in the surface sediment of the dumping ground outside Jiaozhou Bay and their potential ecological risk].

Based on the monitoring data of heavy metals (Cr, Hg, Cd, Pb, Zn, Cu) in the surface sediment of the dumping ground outside Jiaozhou Bay from 2003 to 2008, the distribution patterns, factors controlling the distribution, and the potential ecological risks of heavy metals were studied with the data in 2007-08, and the fluctuation trends of heavy metals in the surface sediment over the 6 years were also discussed. The average concentrations of heavy metals Cr, Hg, Cd, Pb, Zn, Cu in the surface sediment were 29.47, 0.