Human neurotropic polyomavirus, JC virus, late coding region encodes a novel nuclear protein, ORF4, which targets the promyelocytic leukemia nuclear bodies (PML-NBs) and modulates their reorganization.

We previously reported the discovery and characterization of two novel proteins (ORF1 and ORF2) generated by the alternative splicing of the JC virus (JCV) late coding region. Here, we report the discovery and partial characterization of three additional novel ORFs from the same coding region, ORF3, ORF4 and ORF5, which potentially encode 70, 173 and 265 amino acid long proteins respectively. While ORF3 protein exhibits a uniform distribution pattern throughout the cells, we were unable to detect ORF5 expression.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production.

A comprehensive proteomics analysis of JC virus Agnoprotein-interacting proteins: Agnoprotein primarily targets the host proteins with coiled-coil motifs.

JC virus (JCV) Agnoprotein (Agno) plays critical roles in successful completion of the viral replication cycle. Understanding its regulatory roles requires a complete map of JCV-host protein interactions. Here, we report the first Agno interactome with host cellular targets utilizing "Two-Strep-Tag" affinity purification system coupled with mass spectroscopy (AP/MS).

Expression of novel proteins by polyomaviruses and recent advances in the structural and functional features of agnoprotein of JC virus, BK virus, and simian virus 40.

Polyomavirus family consists of a highly diverse group of small DNA viruses. The founding family member (MPyV) was first discovered in the newborn mouse in the late 1950s, which induces solid tumors in a wide variety of tissue types that are the epithelial and mesenchymal origin. Later, other family members were also isolated from a number of mammalian, avian and fish species.

Discovery and characterization of novel trans-spliced products of human polyoma JC virus late transcripts from PML patients.

Although the human neurotropic polyomavirus, JC virus (JCV), was isolated almost a half century ago, understanding the molecular mechanisms governing its biology remains highly elusive. JCV infects oligodendrocytes and astrocytes in the central nervous system (CNS) and causes a rare fatal brain disease known as progressive multifocal leukoencephalopathy (PML) in immunocompromised individuals including AIDS. It has a small circular DNA genome (∼5 kb) and generates two primary transcripts from its early and late coding regions, producing several predicted alternatively spliced products mainly by cis-splicing.

Structure-based release analysis of the JC virus agnoprotein regions: A role for the hydrophilic surface of the major alpha helix domain in release.

Agnoprotein (Agno) is an important regulatory protein of JC virus (JCV), BK virus (BKV) and simian virus 40 (SV40) and these viruses are unable to replicate efficiently in the absence of this protein. Recent 3D-NMR structural data revealed that Agno contains two alpha-helices (a minor and a major) while the rest of the protein adopts an unstructured conformation (Coric et al., 2017, J Cell Biochem).

Nuclear Magnetic Resonance Structure of the Human Polyoma JC Virus Agnoprotein.

Agnoprotein is an important regulatory protein of the human polyoma JC virus (JCV) and plays critical roles during the viral replication cycle. It forms highly stable dimers and oligomers through its Leu/Ile/Phe-rich domain, which is important for the stability and function of the protein. We recently resolved the partial 3D structure of this protein by NMR using a synthetic peptide encompassing amino acids Thr17 to Gln52, where the Leu/Ile/Phe- rich region was found to adopt a major alpha-helix conformation spanning amino acids 23-39.

Emerging From the Unknown: Structural and Functional Features of Agnoprotein of Polyomaviruses.

Agnoprotein is an important regulatory protein of polyomaviruses, including JCV, BKV, and SV40. In the absence of its expression, these viruses are unable to sustain their productive life cycle. It is a highly basic phosphoprotein that localizes mostly to the perinuclear area of infected cells, although a small amount of the protein is also found in nucleus.

Dysregulation of autophagy by HIV-1 Nef in human astrocytes.

Viruses often exploit autophagy, a common cellular process of degradation of damaged proteins, organelles, and pathogens, to avoid destruction. HIV-1 dysregulates this process in several cell types by means of Nef protein. Nef is a small HIV-1 protein which is expressed abundantly in astrocytes of HIV-1-infected brains and has been suggested to have a role in the pathogenesis of HIV-Associated Neurocognitive Disorders (HAND).

WW domain of BAG3 is required for the induction of autophagy in glioma cells.

Autophagy is an evolutionarily conserved, selective degradation pathway of cellular components that is important for cell homeostasis under healthy and pathologic conditions. Here we demonstrate that an increase in the level of BAG3 results in stimulation of autophagy in glioblastoma cells. BAG3 is a member of a co-chaperone family of proteins that associates with Hsp70 through a conserved BAG domain positioned near the C-terminus of the protein.

Nuclear magnetic resonance structure revealed that the human polyomavirus JC virus agnoprotein contains an α-helix encompassing the Leu/Ile/Phe-rich domain.

Unlabelled: Agnoprotein is a small multifunctional regulatory protein required for sustaining the productive replication of JC virus (JCV). It is a mostly cytoplasmic protein localizing in the perinuclear area and forms highly stable dimers/oligomers through a Leu/Ile/Phe-rich domain. There have been no three-dimensional structural data available for agnoprotein due to difficulties associated with the dynamic conversion from monomers to oligomers.

Human polyoma JC virus minor capsid proteins, VP2 and VP3, enhance large T antigen binding to the origin of viral DNA replication: evidence for their involvement in regulation of the viral DNA replication.

JC virus (JCV) lytically infects the oligodendrocytes in the central nervous system in a subset of immunocompromized patients and causes the demyelinating disease, progressive multifocal leukoencephalopathy. JCV replicates and assembles into infectious virions in the nucleus. However, understanding the molecular mechanisms of its virion biogenesis remains elusive.

JC virus agnoprotein enhances large T antigen binding to the origin of viral DNA replication: evidence for its involvement in viral DNA replication.

Agnoprotein is required for the successful completion of the JC virus (JCV) life cycle and was previously shown to interact with JCV large T-antigen (LT-Ag). Here, we further characterized agnoprotein's involvement in viral DNA replication. Agnoprotein enhances the DNA binding activity of LT-Ag to the viral origin (Ori) without directly interacting with DNA.

Human polyomavirus JC small regulatory agnoprotein forms highly stable dimers and oligomers: implications for their roles in agnoprotein function.

JC virus (JCV) encodes a small basic phosphoprotein from the late coding region called agnoprotein, which has been shown to play important regulatory roles in the viral replication cycle. In this study, we report that agnoprotein forms highly stable dimers and higher order oligomer complexes. This was confirmed by immunoblotting and mass spectrometry studies.

Infection by agnoprotein-negative mutants of polyomavirus JC and SV40 results in the release of virions that are mostly deficient in DNA content.

Background: Human polyomavirus JC (JCV) is the etiologic agent of a brain disease, known as progressive multifocal leukoencephalopathy (PML). The JCV genome encodes a small multifunctional phospho-protein, agnoprotein, from the late coding region of the virus, whose regulatory functions in viral replication cycle remain elusive. In this work, the functional role of JCV and SV40 agnoproteins in virion release was investigated using a point mutant (Pt) of each virus, where the ATG codon of agnoprotein was mutated to abrogate its expression.

JC virus-induced Progressive Multifocal Leukoencephalopathy.

Progressive multifocal encephalopathy (PML) is a fatal demyelinating disease of the central nervous system (CNS), caused by the lytic infection of oligodendrocytes by a human polyomavirus, JC virus (JCV). PML is rare disease but mostly develops in patients with underlying immunosuppressive conditions, including Hodgkin's lymphoma, lymphoproliferative diseases, in those undergoing antineoplastic therapy and AIDS. However, consistent with the occurrence of PML under immunocompromised conditions, this disease seems to be also steadily increasing among autoimmune disease patients (multiple sclerosis and Crohn's disease), who are treated with antibody-based regimens (natalizumab, efalizumab and rituximab).

Refolding of human beta-1-2 GlcNAc transferase (GnT1) and the role of its unpaired Cys 121.

Human beta1-2N-acetylglucosaminyltransferase (hGnT1) lacking the first 103 amino acids was expressed as a maltose binding protein (MBP) fusion protein in inclusion bodies (IBs) in Escherichia coli and refolded using an oxido-shuffling method. GnT1 mutants were prepared by replacing a predicted unpaired cysteine (C121) with alanine (C121A), serine (C121S), threonine (C121T) or aspartic acid (C121D). A double mutant R120A/C121H, was generated to mimic Gly14, the Caenorhabditis elegans GnT1 counterpart to hGNT1.

Production of N-sulfated polysaccharides using yeast-expressed N-deacetylase/N-sulfotransferase-1 (NDST-1).

Heparan sulfate/heparin N-deacetylase/N-sulfotransferase-1 (NDST-1) is a critical enzyme involved in heparan sulfate/heparin biosynthesis. This dual-function enzyme modifies the GlcNAc-GlcA disaccharide repeating sugar backbone to make N-sulfated heparosan. N-sulfation is an absolute requirement for the subsequent epimerization and O-sulfation steps in heparan sulfate/heparin biosynthesis.

Preparation and characterization of a 5'-deazaFAD T491V NADPH-cytochrome P450 reductase.

NADPH-cytochrome P450 reductase is a flavoprotein which contains both an FAD and FMN cofactor. Since the distribution of electrons is governed solely by the redox potentials of the cofactors, there are nine different ways the electrons can be distributed and hence nine possible unique forms of the protein. More than one species of reductase will exist at a given level of oxidation except when the protein is either totally reduced or oxidized.

Overexpression and purification of the membrane-bound cytochrome P450 2B4.

Expression of the membrane-bound cytochrome P450 2B4 by the pLW01-P450 expression vector, which utilizes a T7 promoter, is markedly improved by employing Escherichia coli strain C41(DE3) [Miroux, B., and Walker, J. (1996) J.

Roles of the ccoGHIS gene products in the biogenesis of the cbb(3)-type cytochrome c oxidase.

In many bacteria the ccoGHIS cluster, located immediately downstream of the structural genes (ccoNOQP) of cytochrome cbb(3) oxidase, is required for the biogenesis of this enzyme. Genetic analysis of ccoGHIS in Rhodobacter capsulatus demonstrated that ccoG, ccoH, ccoI and ccoS are expressed independently of each other, and do not form a simple operon. Absence of CcoG, which has putative (4Fe-4S) cluster binding motifs, does not significantly affect cytochrome cbb(3) oxidase activity.

An engineered cytochrome b6c1 complex with a split cytochrome b is able to support photosynthetic growth of Rhodobacter capsulatus.

The ubihydroquinone-cytochrome c oxidoreductase (or the cytochrome bc1 complex) from Rhodobacter capsulatus is composed of the Fe-S protein, cytochrome b, and cytochrome c1 subunits encoded by petA(fbcF), petB(fbcB), and petC(fbcC) genes organized as an operon. In the work reported here, petB(fbcB) was split genetically into two cistrons, petB6 and petBIV, which encoded two polypeptides corresponding to the four amino-terminal and four carboxyl-terminal transmembrane helices of cytochrome b, respectively. These polypeptides resembled the cytochrome b6 and su IV subunits of chloroplast cytochrome b6f complexes, and together with the unmodified subunits of the cytochrome bc1 complex, they formed a novel enzyme, named cytochrome b6c1 complex.