Objectives: Patient expectations have the ability to influence health outcomes and have been shown to play an important role as part of the placebo effect to influence the response to medical treatments. Increasing positive expectations have been proposed as an intervention to improve treatment response, although evidence for this to date is limited. We investigated whether a brief 10-min intervention directly targeting patient expectations prior to an iron infusion could enhance expectations and improve treatment response, in terms of patients' reported fatigue.
View Article and Find Full Text PDFThe c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity.
View Article and Find Full Text PDFThe DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions.
View Article and Find Full Text PDFBackground: A team of visiting surgeons has provided regular clinics and day surgery to rural locations in country towns away from resident surgical centres. This format has provided continuity of care for 7 years despite a constantly changing medical workforce. The aim of the present study was to review the results of the group and to compare them against national standards and to provide a model for future outreach programmes.
View Article and Find Full Text PDFBackground: Access to diagnostic endoscopy is limited in rural and remote Western Australia. Published reports suggest open access referrals may result in over-servicing, this is reduced by adherence to the American Society for Gastrointestinal Endoscopy (ASGE) guidelines. The aim was to assess whether an outreach surgical service offering open access endoscopy to rural areas was being over utilized.
View Article and Find Full Text PDF