Gastric distension and duodenal lipid infusion modulate intestinal gas transit and tolerance in humans.

Objective: Patients with unexplained abdominal complaints often attribute their symptoms to intestinal gas and indicate that symptoms are exacerbated by ingestion of a meal. However, the mechanisms responsible are unknown. Our aim was to analyze the specific influence of two meal-related factors, gastric distension, and intestinal nutrients, on intestinal gas dynamics and tolerance.

[Epidemiology of hip fractures in the elderly in Spain].

Background: Ninety percent of hip fractures (HF) occur in people older than 64 years. We describe the epidemiological data (age, sex, date of admission and discharge and mortality) of elderly with hip fracture in the different regions of Spain.

Method: Data obtained from the Minimum Data Set of the Ministry of Health were used to analyse hip fracture incidence (Identified by codes 820.

Pathologic changes related to CMF primary chemotherapy in breast cancer. Pathological evaluation of response predicts clinical outcome.

The pathologic changes associated to response to primary chemotherapy in a series of 303 operable breast cancers are evaluated and correlated to patients' follow-up (interval free of disease and survival). In our series, the incidence of microscopic changes related to chemotherapy is 43.9%.

Lipid-induced intestinal gas retention in irritable bowel syndrome.

Background & Aims: We hypothesized that lipids, which induce various motor and sensory effects on the gut, modulate intestinal gas dynamics and that alteration of this regulatory mechanism may result in impaired gas transit in patients with irritable bowel syndrome (IBS).

Methods: In 45 healthy subjects and 30 patients with IBS, evacuation of gas infused into the jejunum (at 12 mL/min) was measured for 2 hours. The effect of simultaneous duodenal perfusion of lipids at 0 kcal/min (saline), 0.

Numular headache: a coin-shaped cephalgia.

Numular headache is a chronic, mild to moderate, pressurelike pain in a circumscribed cranial area of approximately 2 to 6 cm in diameter. Pain usually is limited to the parietal region, although it may appear in any cranial site. It is a benign process of usually unknown origin.

Prokinetic effects in patients with intestinal gas retention.

Background & Aims: We have previously shown that patients with irritable bowel syndrome (IBS) have impaired transit of intestinal gas loads. Because abnormal gas retention can be experimentally reproduced in healthy subjects by pharmacological inhibition of gut motility, we hypothesized that impaired gas transit and retention can be reciprocally corrected by pharmacologically stimulating intestinal propulsion.

Methods: In 28 patients with abdominal bloating (14 IBS, 14 functional bloating) and in 14 healthy subjects, gas evacuation and perception of jejunal gas infusion (12 mL/min) were measured.

Degradation of phenol by Rhodococcus erythropolis UPV-1 immobilized on Biolite in a packed-bed reactor.

A strain of Rhodococcus erythropolis has been isolated and identified by 16S rRNA sequencing. Cells acclimated to phenol can be adsorbed on the external surface of beads of the ceramic support Biolite where they grow forming a network of large filaments. Exponentially-growing cells were adsorbed faster than their stationary-phase counterparts.

First Report of Broad bean wilt virus 1 in Spain.

In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No.

Biodegradation of phenol in synthetic and industrial wastewater by Rhodococcus erythropolis UPV-1 immobilized in an air-stirred reactor with clarifier.

Phenol biodegradation by suspended and immobilized cells of Rhodococcus erythropolis UPV-1 was studied in discontinuous and continuous mode under optimum culture conditions. Phenol-acclimated cells were adsorbed on diatomaceous earth, where they grew actively forming a biofilm of short filaments. Immobilization protected cells against phenol and resulted in a remarkable enhancement of their respiratory activity and a shorter lag phase preceding active phenol degradation.

Formaldehyde removal in synthetic and industrial wastewater by Rhodococcus erythropolis UPV-1.

Rhodococcus erythropolis strain UPV-1 is able to grow on phenol as the only carbon and energy source and to remove formaldehyde completely from both synthetic and industrial wastewater. The rate of formaldehyde removal is independent of either initial biomass or formaldehyde concentration. The presence of viable, intact cells is strictly necessary for this removal to take place.

Parkinson's disease is associated with oxidative stress: comparison of peripheral antioxidant profiles in living Parkinson's, Alzheimer's and vascular dementia patients.

Antioxidant profiles in Parkinson's disease (PD; n = 15), dementias of Alzheimer's type (DAT; 18) and Vascular (VD; 15), and control subjects (C; 14) were studied. Cu-Zn superoxide dismutase (SOD), catalase (CAT), glutathione system (GLU) and thiobarbituric acid reactive substances (TBARS) were measured in erythrocytes; antioxidant capacity (TRAP) in plasma. Biochemical variables were analyzed simultaneously using multi-variate and non-parametric methods.

Linear regression and computational neural network prediction of tetrahymena acute toxicity for aromatic compounds from molecular structure.

A quantitative structure toxicity relationship (QSTR) has been derived for a diverse set of 448 industrially important aromatic solvents. Toxicity was expressed as the 50% growth impairment concentration (ICG(50)) for the ciliated protozoa Tetrahymena and spans the range -1.46 to 3.

Evaluation of an automated method for the quantification of von Willebrand factor antigen. Its application in the study of vascular dysfunction.

Background And Objectives: Abnormally high levels of von Willebrand factor (VWF) have been described as a response to physiologic and chronic alterations. It is therefore of great interest to have sensitive, accurate, fast and easy to use assays to quantify VWF. The aim of this study was to evaluate the performance characteristics of the immunoturbidimetric assay IL Test VWF:Ag and the use of this determination in the study of vascular dysfunction.

Biological activity of complexes derived from thiophene-2-carbaldehyde thiosemicarbazone. Crystal structure of [Ni(C(6)H(6)N(3)S(2))(2)].

The crystal structure of [Ni(L(III))(2)] (1), where HL(III)=thiophene-2-carbaldehyde thiosemicarbazone, consists of monomeric entities where the nickel(II) ions exhibit distorted square planar geometry. The two bidentate thiosemicarbazone ligands are centrosymmetric. C.

Slowly conducting afferents activated by innocuous low temperature in human skin.

1. Microneurography was used to search for primary afferents responsive to innocuous low temperature in human nerves supplying the hairy skin of the hand or foot. Eighteen units were identified as cold-specific units: they displayed a steady-state discharge at skin temperatures in the range 28-30 degrees C, they were sensitive to small changes in temperature, and they responded vigorously when a cool metal probe touched their receptive fields (RFs).

[Can the Brucellacapt test be substituted for the Coombs test in the diagnosis of human brucellosis?].

Background: Throughout this work we have studied the capacity of Brucellacapt test to replace Coombs test in the serological diagnosis of human brucellosis.

Methods: A total of 66 initial sera from patients with diagnostic of brucellosis were studied. The patients were divided in two groups: 42 patients showing a primo-infection (group1), and 24 patients with a previous case of brucellosis (group 2).

Mechanisms of intestinal gas retention in humans: impaired propulsion versus obstructed evacuation.

To explore the clinical role of intestinal gas dynamics, we investigated two potential mechanisms of gas retention, defective propulsion and obstructed evacuation. In healthy subjects, a gas mixture was continuously infused into the jejunum (4 ml/min) 1) during a 2-h control period of spontaneous gas evacuation and 2) during a 2-h test period either with impaired gut propulsion caused by intravenous glucagon (n = 6) or with obstructed (self-restrained) anal evacuation (n = 10) while anal gas evacuation, symptom perception (0-6 scale), and abdominal girth were measured. Impaired gut propulsion and obstructed evacuation produced similar gas retention (558 +/- 68 ml and 407 +/- 85 ml, respectively, vs.

Biological activity of complexes derived from pyridine-2-carbaldehyde thiosemicarbazone. Structure of.

Biological studies on [Fe(L)2](NO3).0.5H2O (1), [Fe(L)2][PF6] (2), [Co(L)2](NCS) (3), [Ni(HL)2]Cl2.

Impaired transit and tolerance of intestinal gas in the irritable bowel syndrome.

Background: Patients with irritable bowel syndrome (IBS) frequently complain of excessive gas but their fasting volume of intestinal gas is apparently normal. We hypothesised that the pathophysiological mechanism involved may be impairment of intestinal gas transit.

Aim: To investigate intestinal gas transit and tolerance in IBS patients compared with healthy subjects.

Is the reversed fourth dorsal metacarpal flap reliable?

We have carried out a study to determine if a flap based on vessels in the fourth metacarpal space could be used safely. We studied ten fresh cadaver specimens and used the flap in nine patients. In the anatomical study, we confirmed the presence of a suitable artery in nine out of the ten hands, arising from a piercing artery at the metacarpal bases, running distally under the fascia.

Comparison of the determination of superoxide dismutase and antioxidant capacity in neurological patients using two different procedures.

As oxidative stress in relation with neurological diseases has become an important point in recent research, simple methods to be used in epidemiological studies and clinical practice are required. The hypothesis that the analytical methods used in research laboratories (RLM) can be used interchangeably with commercial kits (CKM) for SOD and TRAP is tested. Both methods were compared using linear transformations of the RLM measurements into the CKM scales.

[Cerebrovascular disease and gait disorders: qualitative and quantitative analysis].

Introduction And Objective: Pyramidal gait impairment (GI) is a classical trait of cerebrovascular disease (CVD). To developed a method to quantify prospectively and transversely GI and disequilibrium, to be applied in the screening of pyramidal and non-pyramidal syndromes associated to different ethiological subtypes of CVD; using an Index of Gait and Equilibrium (IGE).

Patients And Methods: In constructing IGE, we used 14 equally weighted semiological variables: 6 measure balance, 6 gait, 1 sensitive abnormalities and 1 falls.