Fc glycan sialylation of biotherapeutic monoclonal antibodies has limited impact on antibody-dependent cellular cytotoxicity.

It has been well documented that the terminal sugars of Fc glycans can play a critical role in the safety and efficacy of therapeutic mAbs. However, many of the effects of highly heterogeneous Fc glycan structures have yet to be fully characterized. Different glycosylation patterns can affect Fc-dependent activities, such as the ability of mAbs to bind Fcγ receptors on the effector cell surface, which is critical to immune effector functions, such as antibody-dependent cellular cytotoxicity (ADCC).

Improved sequence variant analysis strategy by automated false positive removal.

Sequence variant analysis (SVA) is critical in therapeutic protein development because it ensures the absence of genetic mutations of a production clone or high-level misincorporations during cell culture. While software for searching sequence variants from mass spectrometry data are available, effectively distinguishing true positives from a large number of false positives in the reported hits or identifications found in the error tolerant search mode is a challenge. This verification process must be done manually and can take several days or even weeks to accomplish.

On the Molecular Evolution of Leptin, Leptin Receptor, and Endospanin.

Over a decade passed between Friedman's discovery of the mammalian leptin gene (1) and its cloning in fish (2) and amphibians (3). Since 2005, the concept of gene synteny conservation (vs. gene sequence homology) was instrumental in identifying leptin genes in dozens of species, and we now have leptin genes from all major classes of vertebrates.

Evidence for an imidazoline by-product from glycans using tandem mass spectrometry.

Herein is reported the separation and identification of a previously unknown imidazoline by-product originating from the fluorescent labeling procedure when applied to enzymatically released N-linked glycans of a human IgG1. The imidazoline by-product was generated via the reductive amination procedure with either sodium cyanoborohydride or 2-picoline borane. Using ultra performance liquid chromatography (UPLC) in conjunction with hydrophilic interaction-based chromatography (HILIC), the 2-aminobenzoic acid (2-AA)-labeled glycans were well-resolved from imidazoline by-products to facilitate direct identification utilizing electrospray ionization mass spectrometry (ESI-MS) with fragmentation.

Seasonal and Ontogenetic Variation in Subcutaneous Adipose Of the Bowhead Whale (Balaena mysticetus).

Cetacean evolution was shaped by an extraordinary land-to-sea transition in which the ancestors of whales became fully aquatic. As part of this transition, these mammals evolved unusually thick blubber which acts as a metabolic reservoir as well as an insulator and provides buoyancy and streamlining. This study describes blubber stratification and correlates it to seasonal variation, feeding patterns, and ontogeny in an arctic-adapted mysticete, the bowhead whale (Balaena mysticetus).

Discovery of the elusive leptin in birds: identification of several 'missing links' in the evolution of leptin and its receptor.

Leptin is a pleiotropic protein best known for regulation of appetite and fat storage in mammals. While many leptin orthologs have been identified among vertebrates, an authentic leptin in birds has remained elusive and controversial. Here we identify leptin sequence from the Peregrine falcon, Falco peregrinus (pfleptin), and identify sequences from two other birds (mallard and zebra finch), and 'missing' vertebrates (elephant shark, alligator, Indian python, Chinese soft-shelled turtle, and coelacanth).

Comparative endocrinology of leptin: assessing function in a phylogenetic context.

As we approach the end of two decades of leptin research, the comparative biology of leptin is just beginning. We now have several leptin orthologs described from nearly every major clade among vertebrates, and are moving beyond gene descriptions to functional studies. Even at this early stage, it is clear that non-mammals display clear functional similarities and differences with their better-studied mammalian counterparts.

Leptin in whales: validation and measurement of mRNA expression by absolute quantitative real-time PCR.

Leptin is the primary hormone in mammals that regulates adipose stores. Arctic adapted cetaceans maintain enormous adipose depots, suggesting possible modifications of leptin or receptor function. Determining expression of these genes is the first step to understanding the extreme physiology of these animals, and the uniqueness of these animals presents special challenges in estimating and comparing expression levels of mRNA transcripts.

Leptin in teleost fishes: an argument for comparative study.

All organisms face tradeoffs with regard to how limited energy resources should be invested. When is it most favorable to grow, to reproduce, how much lipid should be allocated to storage in preparation for a period of limited resources (e.g.

Expression of leptin receptor gene in developing and adult zebrafish.

Interactions of leptin and leptin receptors play crucial roles during animal development and regulation of appetite and energy balance. In this study we analyzed expression pattern of a zebrafish leptin receptor gene in both developing and adult zebrafish using in situ hybridization and Q-PCR methods. Zebrafish leptin receptor message (lepr) was detected in all embryonic and larval stages examined, and in adult zebrafish.

Release of DNA oligonucleotides and their conjugates from controlled-pore glass under thermolytic conditions.

The sequential functionalization of long-chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and a dinucleoside phosphorotetrazolide leads to a uniquely engineered support for solid-phase synthesis. Unlike conventional succinylated-CPG supports, this support is designed to allow oligonucleotide deprotection and elimination of deprotection side-products to proceed without release of the oligonucleotide. When needed, the DNA oligonucleotide can be thermolytically released in 2 hr under essentially neutral conditions.

Application of combined morphological-molecular approaches to the identification of planktonic protists from environmental samples.

The value of molecular databases for unicellular eukaryotic identification and phylogenetic reconstruction is predicated on the availability of sequences and accuracy of taxonomic identifications that accompany those sequences. Biased representation of sequences is due in part to the differing ability to isolate and culture various groups of protists. Techniques that allow for parallel single-cell morphological and molecular identifications have been reported for a few groups of unicellular protists.

Thermolytic release of covalently linked DNA oligonucleotides and their conjugates from controlled-pore glass at near neutral pH.

The functionalization of long chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and its conversion to the support 7 has led to the synthesis of DNA oligonucleotides and their 3'- or (3',5')-conjugates. Indeed, CPG support 7 has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. Unlike conventional succinylated CPG supports, this distinctively functionalized support allows oligonucleotide deprotection and removal of the deprotection side products to proceed without releasing the oligonucleotide into the aqueous milieu.

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides.

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.

Expression of cadherin10, a type II classic cadherin gene, in the nervous system of the embryonic zebrafish.

Cadherins are cell surface adhesion molecules that play important roles in development of tissues and organs. In this study, we analyzed expression pattern of cadherin10, a member of the type II classic cadherin subfamily, in the embryonic zebrafish using in situ hybridization methods. cadherin10 message (cdh10) is first and transiently expressed by the notochord.