Publications by authors named "Rayner B"

A series of oligopeptides have been synthesized that are structurally related to the natural agent netropsin. The binding constants to double-stranded polynucleotides as well as the cytostatic activity against both murine human tumor cell lines and the in vitro activity against a range of DNA and RNA viruses have been determined for these novel compounds and some of their synthetic precursors. 1-Methyl-5-nitropyrrole-2-carboxylic acid methyl ester (4), N-[[1-methyl-4-(1-methyl-4-nitropyrrole-2-carboxamido)pyrrol-2- yl]carbonyl]-L-alanine tert-butyl ester (28), and N-[[1-methyl-4-(1-methyl-4-nitropyrrole-2-carboxamido)pyrrol-2- yl]carbonyl]-L-alanyl-L-alanine tert-butyl ester (29) showed modest inhibitory effect on tumor cell proliferation (CD50 = 26-85 micrograms/mL).

View Article and Find Full Text PDF

Oligonucleotide analogs consisting exclusively of alpha-anomeric deoxynucleoside units bridged with phosphorothioate linkages have been synthesized and tested in vitro as antiviral agents against human immunodeficiency virus (HIV) in human T cells. Two 28-mers, an homopolymer alpha-S-dC28 and an oligomer alpha-S-anti-rev complementary to the initiation site of the regulatory viral gene rev exhibited antiviral activities comparable to those reported for the corresponding beta-anomeric phosphorothioate analogs. In contrast, a nuclease-resistant homopolymer, alpha-dC28 was inactive.

View Article and Find Full Text PDF

Short (14 to 20-mer range) synthetic oligodeoxyribonucleotides (oligos) allow to modulate specifically viral or cellular gene expression at various stages thus providing a versatile tool for fundamental studies and a rational approach to antiviral chemotherapy. Several problems, such as metabolic stability and efficient cell internalization of oligos, still limit this approach appreciably, as briefly discussed here. We demonstrate here that the conjugation of 15-mer (beta)-anomeric oligos to poly(L-lysine) allows a specific protection of various cell lines against vesicular stomatitis virus infection at concentrations lower than 1 microM.

View Article and Find Full Text PDF

Nuclease-resistant alpha-anomeric DNA:beta-RNA hybrids are inhibitors of Escherichia coli RNase H, and Drosophila embryo RNase H. RNase H activities were measured by polyacrylamide gel electrophoresis, employing a short substrate, (A)12:d[G-G-(T)12-G-G], or by acid-solubility techniques, using a long substrate, poly(A):poly(dT). Strand exchanges which could be responsible for the observed inhibition have been ruled out by S1 nuclease experiments and by using inhibitors which do not allow strand exchange.

View Article and Find Full Text PDF

Over a one-year period 239 patients with community-acquired bacteraemia were studied prospectively to evaluate their clinical profile, course and outcome. Gram-negative organisms accounted for 108 (45 per cent) episodes of bacteraemia, Gram-positive 121 (51 per cent) and polymicrobial 10 (4 per cent). The organisms isolated most commonly were E.

View Article and Find Full Text PDF

Degradation of a synthetic alpha-oligodeoxynucleotide was studied in order to compare its survival with naturally occurring beta-oligodeoxynucleotides in five systems used for antisense hybridization arrest experiments. In contrast to beta-oligodeoxynucleotides, alpha-oligodeoxynucleotides were not detectably degraded over 24 h at 37 degrees C in HeLa cell postmitochondrial cytoplasmic extract or RPMI 1640 with 10% fetal bovine serum, and showed significant survival after 24 h at 37 degrees C in rabbit reticulocyte lysate, fetal bovine serum and human serum.

View Article and Find Full Text PDF

Reductive amination of 3'-apurinic octathymidylate with 9-aminoellipticine provides octathymidylate covalently linked to intercalating ellipticine through a 3,4-dihydroxypentamethylene linker. Studies of its binding properties to poly(rA) reveals the formation of two different complexes depending of the temperature (Tm 13 degrees C and 38 degrees C) with dT/rA stoichiometry respectively equal to 2/1 and 1/1. When compared to parent octathymidylate, stability of the latter duplex is enhanced by the interaction energy provided by the dye moiety.

View Article and Find Full Text PDF

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields.

View Article and Find Full Text PDF

alpha and beta-anomeric d(G2T12G2) oligodeoxyribonucleotides were compared for their hybridization to rA12: the observed melting temperatures are 27 degrees C for beta-oligodeoxyribonucleotide/RNA hybrid and 53 degrees C for alpha-oligodeoxyribonucleotide/RNA. alpha-oligonucleotides with the four bases, complementary to natural mRNAs, were synthesized for the first time, labeled at their 5'-end with [32P] and used as probes in Northern blot experiments. In spite of these higher affinities for their target RNA's, they were unable to block translation of natural or synthetic mRNA's in rabbit reticulocyte lysate.

View Article and Find Full Text PDF

The beta-complementary hexamer, beta-d[GTACGC], to the alpha-sequence, alpha-d[CATGCG], was synthesized by the phosphotriester method. The non-exchangeable proton assignments were obtained using 1D- and 2D-NMR techniques, including NOE, COSY and NOESY. The beta-strand exists as a random coil at 21 degrees C; however, at 4 degrees C, it forms an antiparallel self-recognition duplex annealing at positions 1-4.

View Article and Find Full Text PDF

A new set of molecules made of an intercalating agent (oxazolopyridocarbazole, OPC) covalently linked through a polymethylene chain of various length to the 3' end of alpha-anomeric or beta-anomeric tetradeoxynucleotides (alpha- or beta-T4) have been synthesized. The beta-thymidylate modified compound (beta-T4C5OPC) is able to interact with the complementary sequence, beta-poly (rA); this interaction is strongly stabilized compared to the parent compound, beta-oligo(dT)4 and is specific for poly (rA). The molecule synthesized from the unnatural alpha-anomer, alpha-T4C5OPC, is also able to interact with poly (rA) leading to the formation of an alpha-beta hybrid stabilized by the energy provided by the OPC moiety.

View Article and Find Full Text PDF

The complementary consensus donor exon intron junction d(ApCpTpTpApCpCpTpG) has been synthesized by a solid phase procedure. The non-exchangeable proton assignments were obtained using one- and two-dimensional NMR techniques including NOE, COSY, NOESY and 1H-1H-INADEQUATE. The non self-complementary nonamer exists as a random coil form in aqueous buffer at 21 degrees C as evidenced by the temperature variable 1H-NMR and NOE measurements.

View Article and Find Full Text PDF

Lactrodectus indistinctus (button spider) is widely distributed in South Africa. However, the incidence of lactrodectism is unknown and no case reports have appeared recently. The importance of the recognition of this syndrome is stressed since a history or evidence of the spider bite may be absent or overlooked.

View Article and Find Full Text PDF

High field 2-D-1H-NMR techniques permitted the assignment of all non-exchangeable protons of the unnatural deoxyribonucleotides alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)]. 1-D and 2-D NOESY experiments show strong H6H8-H4' dipolar interactions for all nucleotides in both sequences. These data, together with COSY and J-resolved spectra, indicate that these two alpha-oligomers adopt 3'-exo conformations of the sugar moieties in solution with anti conformations of the glycosyl linkages.

View Article and Find Full Text PDF

This paper describes for the first time the synthesis of alpha-oligonucleotides containing the four usual bases. Two unnatural hexadeoxyribonucleotides: alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)], consisting only of alpha-anomeric nucleotide units, were obtained by an improved phosphotriester method, in solution. Starting material was the four base-protected alpha-deoxyribonucleosides 3a-d.

View Article and Find Full Text PDF

The progression from the early pre-pulseless to the pulseless state in an unusual case of Takayasu's arteritis is presented. Several uncommon associated features are also described. The importance of the findings is briefly discussed.

View Article and Find Full Text PDF

The complementary consensus acceptor exon:intron junction d(ApCpCpTpGpTpApG) has been synthesized by a modified phosphotriester method. The non self-complementary octamer exists in the random coil form in aqueous buffer at 20 degrees C as evidenced by temperature variable 1H-NMR and NOE measurements. The non-exchangeable proton assignments were secured using a combination of techniques including two-dimensional COSY, NOESY and 1H-1H-INADEQUATE.

View Article and Find Full Text PDF

The novel deoxyribonucleotide alpha-[d(CpCpTpTpCpC)] and its complement beta-[d(GpGpApApGpG)] were synthesized by the phosphotriester method. 1H-NMR-NOE examination of the alpha-hexamer revealed that the cytosine and thymine bases appear to adopt anti conformations in this strand. In addition the deoxyribose of the thymidine moieties may adopt average conformations approximating to C3'-endo while the cytidine furanose groups are close to C2'-endo conformations.

View Article and Find Full Text PDF

The consensus acceptor exon:intron junction d(CpTpApCpApGpGpT) has been synthesized by a modified phosphotriester method. The non-self complementary octamer exists in the single strand form in aqueous buffer at 20 degrees C as evidenced by temperature variable 1H-NMR and NOE measurements. The non-exchangeable proton assignments were secured using a combination of techniques including two-dimensional COSY, NOESY and the double quantum technique 1H-1H-INADEQUATE as well as inversion recovery T1 experiments.

View Article and Find Full Text PDF

The synthesis of the model apurinic oligonucleotide Tp(AP)pT is reported. Furthermore during the course of purification of this compound we have shown that the adduct formed upon reaction with methoxyamine has a Schiff base structure.

View Article and Find Full Text PDF

Four athletes developed water intoxication (hyponatremia) during endurance events lasting more than 7 h. The etiology of the condition appears to be voluntary hyperhydration with hypotonic solutions combined with moderate sweat sodium chloride losses. The reason why the fluid excess in these runners was not corrected by increased urinary losses is unknown.

View Article and Find Full Text PDF

The consensus donor exon:intron junction d(CpApGpGpTpApApGpT) has been synthesized by a modified phosphotriester method. The non-self-complementary nonamer has, in principle, only two G,C or four A,T points of self-recognition. The inference that it exists in the single strand form at 20 degrees C was confirmed by temperature variable 1H-NMR and NOE measurements.

View Article and Find Full Text PDF

The two deoxyribonucleotides [d(CpGpApTpCpG)]2 and [d(CpGpCpG)]2 were synthesized by the phosphotriester method. Their duplex form under the conditions of the 1H-nmr experiments was proven by end 32P labeling with T4 polynucleotide kinase followed by butt end joining employing the absolute specificity of T4 ligase for double stranded DNA and analysis using gel electrophoresis and autoradiography. Complete nmr assignment of the 1H chemical shifts and coupling constants was achieved.

View Article and Find Full Text PDF

Inter-proton nuclear Overhauser enhancements (NOEs) have been used to assign the aromatic, anomeric and 2' resonances in the 1H nuclear magnetic resonance spectrum of the duplex formed between d(T-C-A-C-A-T) and d(A-T-G-T-G-A). The same techniques have been applied to assignments in the hybrid duplex formed by d(T-C-A-C-A-T) with r(A-U-G-U-G-A). Comparison of intra-residue with inter-residue NOEs yields structural information which suggests that the conformations of both duplexes are similar.

View Article and Find Full Text PDF