Self-Assembled Chiral Film Based on Melanin Polymers.

Chirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions.

Electronic Circular Dichroism Detects Conformational Changes Associated with Proteasome Gating Confirmed Using AFM Imaging.

Many chronic diseases, including cancer and neurodegeneration, are linked to proteasome dysregulation. Proteasome activity, essential for maintaining proteostasis in a cell, is controlled by the gating mechanism and its underlying conformational transitions. Thus, developing effective methods to detect gate-related specific proteasome conformations could be a significant contribution to rational drug design.

Enantiomeric Resolution and Enantiomer Isolation of H TPPS4 J-Aggregate from Aqueous Solution Is Enabled by Vortexes.

Protonated achiral H TPPS4 spontaneously self-arranges at acids pH and high ionic strength to build mesoscopic J-aggregates that are intrinsically chiral. According to the symmetry rule aggregation leads to a racemate that, however, can be unbalanced by chemical (chiral pollutants) or physical stimuli (as vortexing the solution). Vortexing the title racemate, in principle, might either induce chiral separation or chiral enrichment.

Modulation of the 20S Proteasome Activity by Porphyrin Derivatives Is Steered through Their Charge Distribution.

Cationic porphyrins exhibit an amazing variety of binding modes and inhibition mechanisms of 20S proteasome. Depending on the spatial distribution of their electrostatic charges, they can occupy different sites on α rings of 20S proteasome by exploiting the structural code responsible for the interaction with regulatory proteins. Indeed, they can act as competitive or allosteric inhibitors by binding at the substrate gate or at the grooves between the α subunits, respectively.

Self-Assembly of Discrete Porphyrin/Calix[4]tube Complexes Promoted by Potassium Ion Encapsulation.

The pivotal role played by potassium ions in the noncovalent synthesis of discrete porphyrin-calixarene nanostructures has been examined. The conformation adopted by the two cavities of octa-cationic calix[4]tube was found to prevent the formation of complexes with well-defined stoichiometry between this novel water-soluble calixarene and the tetra-anionic phenylsulfonate porphyrin . Conversely, preorganization of into a -symmetrical scaffold, triggered by potassium ion encapsulation (@K), allowed us to carry out an efficient hierarchical self-assembly process leading to 2D and 3D nanostructures.

En Route to a Chiral Melanin: The Dynamic "From-Imprinted-to-Template" Supramolecular Role of Porphyrin Hetero-Aggregates During the Oxidative Polymerization of L-DOPA.

Chiral porphyrin hetero-aggregates, produced from meso-tetrakis(4-N-methylpyridyl) porphyrin HT4 and copper(II) meso-tetrakis(4-sulfonatophenyl)porphyrin CuTPPS by an imprinting effect in the presence of L-3,4-dihydroxyphenylalanine (L-DOPA), are shown herein to serve as templates for the generation of chiral structures during the oxidative conversion of the amino acid to melanin. This remarkable phenomenon is suggested to involve the initial role of L-DOPA and related chiral intermediates like dopachrome as templates for the production of chiral porphyrin aggregates. When the entire chiral pool from DOPA is lost, chiral porphyrin hetero-aggregate would elicit axially chiral oligomer formation from 5,6-dihydroxyindole intermediates in the later stages of melanin synthesis.

Cooperative Binding of the Cationic Porphyrin Tris-T4 Enhances Catalytic Activity of 20S Proteasome Unveiling a Complex Distribution of Functional States.

The present study provides new evidence that cationic porphyrins may be considered as tunable platforms to interfere with the structural "key code" present on the 20S proteasome α-rings and, by consequence, with its catalytic activity. Here, we describe the functional and conformational effects on the 20S proteasome induced by the cooperative binding of the tri-cationic 5-(phenyl)-10,15,20-(tri -methyl-4-pyridyl) porphyrin (Tris-T4). Our integrated kinetic, NMR, and in silico analysis allowed us to disclose a complex effect on the 20S catalytic activity depending on substrate/porphyrin concentration.

Covalently Conjugated Gold-Porphyrin Nanostructures.

Gold nanoparticles show important electronic and optical properties, owing to their size, shape, and electronic structures. Indeed, gold nanoparticles containing no more than 30-40 atoms are only luminescent, while nanometer-sized gold nanoparticles only show surface plasmon resonance. Therefore, it appears that gold nanoparticles can alternatively be luminescent or plasmonic and this represents a severe restriction for their use as optical material.

Interactions of mono spermine porphyrin derivative with DNAs.

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC) in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC) .

Photodegradation of Antibiotics by Noncovalent Porphyrin-Functionalized TiO in Water for the Bacterial Antibiotic Resistance Risk Management.

Antibiotics represent essential drugs to contrast the insurgence of bacterial infections in humans and animals. Their extensive use in livestock farming, including aquaculture, has improved production performances and food safety. However, their overuse can implicate a risk of water pollution and related antimicrobial resistance.

The proteasome as a druggable target with multiple therapeutic potentialities: Cutting and non-cutting edges.

Ubiquitin Proteasome System (UPS) is an adaptable and finely tuned system that sustains proteostasis network under a large variety of physiopathological conditions. Its dysregulation is often associated with the onset and progression of human diseases; hence, UPS modulation has emerged as a promising new avenue for the development of treatments of several relevant pathologies, such as cancer and neurodegeneration. The clinical interest in proteasome inhibition has considerably increased after the FDA approval in 2003 of bortezomib for relapsed/refractory multiple myeloma, which is now used in the front-line setting.

Long-Range Chiral Induction by a Fully Noncovalent Approach in Supramolecular Porphyrin-Calixarene Assemblies.

The hierarchical assembly, in aqueous solution, of a new multi-metalloporphyrin/calixarene aggregate has been accomplished. In this supramolecular system transfer of chirality, from the outermost components to the central porphyrin reporter, takes place as a result of favorable and fully noncovalent long-range electronic communication.

Endogenous and artificial miRNAs explore a rich variety of conformations: a potential relationship between secondary structure and biological functionality.

Mature microRNAs are short non-coding RNA sequences which upon incorporation into the RISC ribonucleoprotein complex, play a crucial role in regulation of gene expression. However, miRNAs can exist within the cell also as free molecules fulfilling their biological activity. Therefore, it is emerging that in addition to sequence even the structure adopted by mature miRNAs might play an important role to reach the target.

Polyethersulfone Mats Functionalized with Porphyrin for Removal of Para-nitroaniline from Aqueous Solution.

The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water.

Combined Approach To Remove and Fast Detect Heavy Metals in Water Based on PES-TiO Electrospun Mats and Porphyrin Chemosensors.

Hybrid poly(ether sulfones) (PES)-TiO electrospun mats are used as selective filters to remove lead and zinc ions from water. Presence of TiO is functional to trigger fiber's surface charge that allows for better performances in terms of ionic adsorption with respect to bare PES mats. Temperature increase promotes a speed up of ion removal.

Chiral Recognition of L- and D- Amino Acid by Porphyrin Supramolecular Aggregates.

We report of the interactions between four amino acids lysine (Lys), arginine (Arg), histidine (His), and phenylalanine (Phe) with the J-aggregates of the protonated 5,10,15,20-tetrakis(4-sulfonatophenyl)-porphyrin H₄TPPS. Several aspects of these self-assembled systems have been analyzed: (i) the chiral transfer process; (ii) the hierarchical effects leading to the aggregates formation; and, (iii) the influence of the amino acid concentrations on both transferring and storing chiral information. We have demonstrated that the efficient control on the J-aggregates chirality is obtained when all amino acids are tested and that the chirality transfer process is under hierarchical control.

Design principles of chiral carbon nanodots help convey chirality from molecular to nanoscale level.

The chirality of (nano)structures is paramount in many phenomena, including biological processes, self-assembly, enantioselective reactions, and light or electron spin polarization. In the quest for new chiral materials, metallo-organic hybrids have been attractive candidates for exploiting the aforementioned scientific fields. Here, we show that chiral carbon nanoparticles, called carbon nanodots, can be readily prepared using hydrothermal microwave-assisted synthesis and easily purified.

Chirality Enhancement of Porphyrin Supramolecular Assembly Driven by a Template Preorganization Effect.

Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.

Electrostatic Map Of Proteasome α-Rings Encodes The Design of Allosteric Porphyrin-Based Inhibitors Able To Affect 20S Conformation By Cooperative Binding.

The importance of allosteric proteasome inhibition in the treatment of cancer is becoming increasingly evident. Motivated by this urgent therapeutic need, we have recently identified cationic porphyrins as a highly versatile class of molecules able to regulate proteasome activity by interfering with gating mechanisms. In the present study, the mapping of electrostatic contacts bridging the regulatory particles with the α-rings of the human 20S proteasome led us to the identification of (meso-tetrakis(4-N-methylphenyl pyridyl)-porphyrin (pTMPyPP4) as a novel non-competitive inhibitor of human 20S proteasome.

Stabilization vs. destabilization of G-quadruplex superstructures: the role of the porphyrin derivative having spermine arms.

The interaction of the porphyrin derivative HTCPPSpm4, having spermine pendants in the four meso positions, with the G-quadruplex (GQ) structure formed by the DNA aptamer TGGGAG has been investigated by means of UV, electronic circular dichroism and PAGE studies. The results reported here demonstrate that the porphyrin derivative is capable of stabilizing or destabilizing the higher-ordered structures of parallel GQs, depending on the method used to reach their relative stoichiometry (titration vs. single addition).

A novel porphyrin-based molecular probe ZnTCPPSpm4 with catalytic, stabilizing and chiroptical diagnostic power towards DNA B-Z transition.

In this work we have designed a new zinc(II) porphyrin with four spermines conjugate in the meso positions, meso-tetrakis-(4-carboxysperminephenyl)porphyrin, ZnTCPPSpm4) with the aim of acting as a chiroptical probe for the Z-form of DNA, a high energy transient conformation of DNA. In addition to monitor by Electronic Circular Dichroism chiroptical response the formation of Z-DNA in the presence of micromolar concentration of spermine, this porphyrin based molecular probe is also able to catalyze and stabilize this important DNA structure. The ZnTCPPSpm4 conjugate represents a perfect example of single molecule, which possesses all these three properties at the same time.

Vortexes tune the chirality of graphene oxide and its non-covalent hosts.

Graphene oxide (GO) is one of the most appealing bidimensional materials able to interact non-covalently with achiral molecules and to act as chiral inducers. Vortexes can tune chirality and, consequently transfer a specific handedness to non-covalent host molecules, either when dispersed in water or when deposited on a solid surface.

Chirality of self-assembled achiral porphyrins induced by chiral Zn(ii) Schiff-base complexes and maintained after spontaneous dissociation of the templates: a new case of chiral memory.

Herein, we exploit the induction of chirality by chiral Zn(ii) Schiff-base complexes, followed by their spontaneous dissociation in aqueous solution, providing for the first time a possibility of overcoming the template removal steps, to demonstrate memorization of chirality in porphyrin hetero-aggregates.

Cationic porphyrins are tunable gatekeepers of the 20S proteasome.

The 20S proteasome is a barrel-shaped enzymatic assembly playing a critical role in proteome maintenance. Access of proteasome substrates to the catalytic chamber is finely regulated through gating mechanisms which involve aromatic and negatively charged residues located at the N-terminal tails of α subunits. However, despite the importance of gates in regulating proteasome function, up to now very few molecules have been shown to interfere with the equilibrium by which the catalytic channel exchanges between the open and closed states.