Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

Unravelling aggregation propensity of rotavirus A VP6 expressed as E. coli inclusion bodies through in silico prediction.

The inner capsid protein of rotavirus, VP6, emerges as a promising candidate for next-generation vaccines against rotaviruses owing to its abundance in virion particles and high conservation. However, the formation of inclusion bodies during prokaryotic VP6 expression poses a significant hurdle to rotavirus research and applications. Here, we employed experimental and computational approaches to investigate inclusion body formation and aggregation-prone regions (APRs).

Reverse vaccinology-based multi-epitope vaccine design against Indian group A rotavirus targeting VP7, VP4, and VP6 proteins.

Rotavirus, a primary contributor to severe cases of infantile gastroenteritis on a global scale, results in significant morbidity and mortality in the under-five population, particularly in middle to low-income countries, including India. WHO-approved live-attenuated vaccines are linked to a heightened susceptibility to intussusception and exhibit low efficacy, primarily attributed to the high genetic diversity of rotavirus, varying over time and across different geographic regions. Herein, molecular data on Indian rotavirus A (RVA) has been reviewed through phylogenetic analysis, revealing G1P[8] to be the prevalent strain of RVA in India.

Improving synthesis and binding affinities of nucleic acid aptamers and their therapeutics and diagnostic applications.

Nucleic acid aptamers have captivated the attention of analytical and medicinal scientists globally due to their several advantages as recognition molecules over conventional antibodies because of their small size, simple and inexpensive synthesis, broad target range, and high stability in varied environmental conditions. These recognition molecules can be chemically modified to make them resistant to nuclease action in blood serum, reduce rapid renel clearance, improve the target affinity and selectivity, and make them amenable to chemically conjugate with a support system that facilitates their selective applications. This review focuses on the development of efficient aptamer candidates and their application in clinical diagnosis and therapeutic applications.