Mol Biotechnol
December 2024
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFIn this study, we analyzed the combination of affinity purification mass spectrometry (AP-MS) with high-field asymmetric waveform ion mobility spectrometry (FAIMS), integrated between nanoLC-MS and an Orbitrap Ascend Tribrid Mass Spectrometer. Our primary objective was to evaluate the application of the FAIMS interface for detecting affinity purified SAP25 protein complexes with enhanced sensitivity and robustness. As a result, we observed that nanoLC-FAIMS-MS (with FAIMS) significantly improved the sensitivity and detection limits at the protein level, peptide level and significantly reduced chemical contaminants compared to nanoLC-MS alone without FAIMS (No FAIMS).
View Article and Find Full Text PDFProg Biomed Eng (Bristol)
August 2024
The biomedical applications of metal dichalcogenides (MDCs) nanomaterials (NMs) are an emerging discipline because of their unique attributes like high surface-to-volume ratio, defect sites, superb catalytic performance, and excitation-dependent emission, which is helpful in bio-imaging and cancer cell killing. Due to the compatibility of sensing material with cells and tissues, MoS, WS, and SnSNMs have piqued the interest of researchers in various biomedical applications like photothermal therapy used in killing cancer cells, drug delivery, photoacoustic tomography (PAT) used in bio-imaging, nucleic acid or gene delivery, tissue engineering, wound healing, etc. Furthermore, these NMs' functionalization and defect engineering can enhance therapeutic efficacy, biocompatibility, high drug transport efficiency, adjustable drug release, dispersibility, and biodegradability.
View Article and Find Full Text PDFThe objective of an operating room (OR) ultra-clean ventilation system is to eliminate or reduce the quantity of dust particles and colony-forming units per cubic meter of air (CFU/m). To achieve this, ultra-clean goal high air change rates per hour are required to reduce the particle load and number of CFU/m. To determine the air quality in an ultra-clean OR during surgery, in terms of the number and type of microorganism and quantity of dust particles in order to establish a benchmark.
View Article and Find Full Text PDFPresent work aims to prepare Soluplus stabilized, phospholipid-modified, and cetuximab-conjugated paclitaxel nanocrystals (NCs) as stable nanocarriers for targeted drug delivery. The NCs, prepared using concurrent antisolvent precipitation cum cold crystallization method followed by probe sonication, were found to be monodispersed particles with sub-200 nm size. The microscopic analysis uncovered rod and spherical anisotropy for Soluplus stabilized (PTX-NCs) and phospholipid modified (Lipid/PTX-NCs) nanocrystals, respectively.
View Article and Find Full Text PDF