SIV monoclonal antibody administration spanning treatment interruption in macaques delays viral rebound and selects escape variants.

HIV-1 envelope broadly neutralizing antibodies represent a promising component of HIV-1 cure strategies. To evaluate the therapeutic efficacy of combination monoclonal antibodies (mAbs) in a rigorous nonhuman primate model, we tested different combinations of simian immunodeficiency virus (SIV) neutralizing mAbs in SIVmac251-infected rhesus macaques. Antiretroviral therapy-suppressed animals received anti-SIV mAbs targeting multiple Env epitopes spanning analytical treatment interruption (ATI) in 3 groups (n = 7 each): i) no mAb; ii) 4-mAb combination; and iii) 2-mAb combination.

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

Role of Salivary Protease Enzymatic Activity in Saliva of Children with and without Early Childhood Caries: A Randomized Clinical Trial.

Background/introduction: Early childhood caries (ECC) is one of the most prevalent diseases in children worldwide. Early childhood caries is driven by a dysbiotic state of oral microorganisms, mainly caused by a sugar-rich diet. Additionally, poor oral hygiene or insufficient dental plaque removal leads to the rapid progression of ECC.

Estimation and Correlation of Alkaline Phosphatase Enzymatic Activity in Saliva with and without Early Childhood Caries in South Indian Children: A Randomized Clinical Trial.

Introduction: Early childhood caries (ECC) is a major common problem seen in children and is the most prevalent chronic disease that leads to discomfort, pain, and poor quality of life, affecting the health of children. Alkaline phosphatase (ALP) is a nonspecific phosphomonoesterase that functions through a phosphoery 1 intermediate to produce free inorganic phosphate. It has different isoenzymes produced by different cell types such as polymorphonuclear leukocytes, osteoblasts, macrophages, and fibroblasts within alveolar bone and/or salivary glands.

Unravelling aggregation propensity of rotavirus A VP6 expressed as E. coli inclusion bodies through in silico prediction.

The inner capsid protein of rotavirus, VP6, emerges as a promising candidate for next-generation vaccines against rotaviruses owing to its abundance in virion particles and high conservation. However, the formation of inclusion bodies during prokaryotic VP6 expression poses a significant hurdle to rotavirus research and applications. Here, we employed experimental and computational approaches to investigate inclusion body formation and aggregation-prone regions (APRs).