Oral Health Knowledge and Oral Hygiene Habits in a Sample of 12-Year-Old Hispanics: A Cross-sectional Study.

Objective: To explore the association between hygiene knowledge and habits and gingivitis in Puerto Rican school children.

Methods: Questionnaires on oral health knowledge and hygiene habits were provided to almost half of the 12-year-olds who participated in an island-wide cross-sectional oral health study. The evaluations included gingival examinations in 2 quadrants.

Comparative Analysis of Gene Expression Patterns for Oral Epithelial Cell Functions in Periodontitis.

The structure and function of epithelial cells are critical for the construction and maintenance of intact epithelial surfaces throughout the body. Beyond the mechanical barrier functions, epithelial cells have been identified as active participants in providing warning signals to the host immune and inflammatory cells and in communicating various detailed information on the noxious challenge to help drive specificity in the characteristics of the host response related to health or pathologic inflammation. Rhesus monkeys were used in these studies to evaluate the gingival transcriptome for naturally occurring disease samples (GeneChip® Rhesus Macaque Genome Array) or for ligature-induced disease (GeneChip® Rhesus Gene 1.

Gingival transcriptomics of follicular T cell footprints in progressing periodontitis.

Follicular helper T cells (Tfh) cells have been identified in the circulation and in tertiary lymphoid structures in chronic inflammation. Gingival tissues with periodontitis reflect chronic inflammation, so genomic footprints of Tfh cells should occur in these tissues and may differ related to aging effects. Macaca mulatta were used in a ligature-induced periodontitis model [adult group (aged 12-23 years); young group (aged 3-7 years)].

Oral Microbiome and Gingival Tissue Apoptosis and Autophagy Transcriptomics.

This study focused on documenting characteristics of the gingival transcriptome during various stages of periodontitis targeting genes associated with apoptotic and autophagic pathways and changes that specifically associate with features of the oral microbiome. ( = 18; 12-23 years) were examined at baseline and 0.5, 1, and 3 months of disease progression, as well as 5 months with clinical disease resolution.

Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

Objective: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease.

Background: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection.

Methods: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis.

Comparative Analysis of Gene Expression Patterns for Oral Epithelium-Related Functions with Aging.

Epithelial cells and functions of the epithelium are critical to the health of the oral cavity. We used a nonhuman primate model to profile the transcriptome of gingival tissues in health across the lifespan and hypothesized that in older animals, epithelial-related transcriptome patterns would reflect epithelial cells that are aggressively responsive to the surrounding environment and less able to modulate and resolve the noxious challenge from the bacteria. Rhesus monkeys (n = 34) with a healthy periodontium were distributed into four groups: ≤3 years (young), 3-7 years (adolescent), 12-16 years (adult), and 18-23 years (aged), and a buccal gingival sample from the premolar/molar region of each animal was obtained.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Comparative analysis of expression of microbial sensing molecules in mucosal tissues with periodontal disease.

Host-derived pattern recognition receptors (PRRs) are necessary for effective innate immune engagement of pathogens that express microbial-associated molecular patterns (MAMP) ligands for these PRRs. This study used a nonhuman primate model to evaluate the expression of these sensing molecules in gingival tissues. Macaca mulatta aged 12-24 with a healthy periodontium (n = 13) or periodontitis (n = 11) provided gingival tissues for assessment of naturally-occurring periodontitis.

Periodontal disease susceptible matrilines in the Cayo Santiago Macaca mulatta macaques.

Objective And Background: The expression of periodontitis, including age of onset, extent, and severity is considered to represent an interaction of the individual's oral microbiome and host response to the microbial challenge that is modified by both genetics and environmental factors. The aim of this study was to determine the distribution of periodontitis in a population of nonhuman primates, to document features of familial distribution that could reflect heritability and transmission of microbes with enhanced virulence.

Material And Methods: This report presents our findings from evaluation of periodontal disease bone defects in skulls from 569 animals (5-31 years of age) derived from the skeletons of the rhesus monkeys (Macaca mulatta) of Cayo Santiago derived from eight matrilines over 6-9 generations.

Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates.

Background: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and 16 NP receptors (NPRs) coincident with the initiation, progression, and resolution of periodontitis were determined.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear.

Hypoxia-inducible transcription factors, HIF1A and HIF2A, increase in aging mucosal tissues.

Hypoxia (i.e. oxygen deprivation) activates the hypoxia-signalling pathway, primarily via hypoxia-inducible transcription factors (HIF) for numerous target genes, which mediate angiogenesis, metabolism and coagulation, among other processes to try to replenish tissues with blood and oxygen.

Comparative analysis of microbial sensing molecules in mucosal tissues with aging.

Host-bacterial interactions at mucosal surfaces require recognition of the bacteria by host cells enabling targeted responses to maintain tissue homeostasis. It is now well recognized that an array of host-derived pattern recognition receptors (PRRs), both cell-bound and soluble, are critical to innate immune engagement of microbes via microbial-associated molecular patterns (MAMP). This report describes the use of a nonhuman primate model to evaluate changes in the expression of these sensing molecules related to aging in healthy gingival tissues.

Transcriptome Analysis of B Cell Immune Functions in Periodontitis: Mucosal Tissue Responses to the Oral Microbiome in Aging.

Evidence has shown activation of T and B cells in gingival tissues in experimental models and in humans diagnosed with periodontitis. The results of this adaptive immune response are noted both locally and systemically with antigenic specificity for an array of oral bacteria, including periodontopathic species, e.g.

Bone biology-related gingival transcriptome in ageing and periodontitis in non-human primates.

Aim: Cellular and molecular immunoinflammatory changes in gingival tissues drive alveolar bone loss in periodontitis. Since ageing is a risk factor for periodontitis, we sought to identify age-related gingival transcriptome changes associated with bone metabolism in both healthy and in naturally occurring periodontitis.

Materials And Methods: Adult (12-16 years) and aged (18-23 years) non-human primates (M.

Persistent oral health disparity in 12-year-old Hispanics: a cross-sectional study.

Background: Dental caries is the most prevalent chronic illness worldwide. In the US dental caries has been described as a "silent epidemic", affecting 58.2 % of 12-15 year-olds, particularly in minority and immigrant groups.

Differential Gene Expression Profiles Reflecting Macrophage Polarization in Aging and Periodontitis Gingival Tissues.

Recent evidence has determined a phenotypic and functional heterogeneity for macrophage populations. This plasticity of macrophage function has been related to specific properties of subsets (M1 and M2) of these cells in inflammation, adaptive immune responses and resolution of tissue destructive processes. This investigation hypothesized that targeted alterations in the distribution of macrophage phenotypes in aged individuals, and with periodontitis would be skewed towards M1 inflammatory macrophages in gingival tissues.

Effects of aging in the expression of NOD-like receptors and inflammasome-related genes in oral mucosa.

The molecular changes underlying the higher risk of chronic inflammatory disorders during aging remain incompletely understood. Molecular variations in the innate immune response related to recognition and interaction with microbes at mucosal surfaces could be involved in aging-related inflammation. We developed an ontology analysis of 20 nucleotide-binding and oligomerization domain (NOD)-like receptors (NLRs) and seven inflammasome-related genes (IRGs) in healthy and inflamed/periodontitis oral mucosal tissues from young, adolescent, adult, and aged non-human primates (Macaca mulatta) using the GeneChip(®) Rhesus Macaque Genome array.

Immune system transcriptome in gingival tissues of young nonhuman primates.

Background And Objective: Young/adolescent humans harbor many microorganisms associated with periodontal disease in adults and show substantial gingival inflammatory responses. However, younger individuals do not demonstrate the soft- and hard-tissue destruction that hallmark periodontitis.

Material And Methods: This study evaluated responses to the oral microbial ecology in gingival tissues from clinically healthy young Macaca mulatta (< 3 years of age) compared with older animals (5-23 years of age).

Familial periodontal disease in the Cayo Santiago rhesus macaques.

Substantial ongoing research continues to explore the contribution of genetics and environment to the onset, extent and severity of periodontal disease(s). Existing evidence supports that periodontal disease appears to have an increased prevalence in family units with a member having aggressive periodontitis. We have been using the nonhuman primate as a model of periodontal disease for over 25 years with these species demonstrating naturally occurring periodontal disease that increases with age.

Cytokine gene expression profiles during initiation, progression and resolution of periodontitis.

Aim: Variations in the expression of cytokines during the progression of periodontitis remain ill-defined. We evaluated the expression of 19 cytokine genes related to T-cell phenotype/function during initiation, progression and resolution of periodontitis, and related these to the expression of soft and bone tissue destruction genes (TDGs).

Materials And Methods: A ligature-induced periodontitis model was used in rhesus monkeys (M.

Diet quality, social determinants, and weight status in Puerto Rican children aged 12 years.

Diet quality may be influenced by social determinants and weight status. This has not been studied in Puerto Rico; therefore, our cross-sectional study examined whether diet quality, assessed by the Healthy Eating Index-2005 (HEI-2005), differs by social determinants (sex, school type, and region) and weight status in children in Puerto Rico. As part of an island-wide study to evaluate oral health in 1,550 children aged 12 years, dietary intake was assessed in a representative subset (n=796) using a 24-hour diet recall.

Comparative analysis of gingival tissue antigen presentation pathways in ageing and periodontitis.

Aim: Gingival tissues of periodontitis lesions contribute to local elevations in mediators, including both specific T cell and antibody immune responses to oral bacterial antigens. Thus, antigen processing and presentation activities must exist in these tissues to link antigen-presenting cells with adaptive immunity. We hypothesized that alterations in the transcriptome of antigen processing and presentation genes occur in ageing gingival tissues and that periodontitis enhances these differences reflecting tissues less capable of immune resistance to oral pathogens.

Effects of aging on apoptosis gene expression in oral mucosal tissues.

Apoptotic processes are important for physiologic renewal of an intact epithelial barrier and contribute some antimicrobial resistance for bacteria and viruses, as well as anti-inflammatory effects that benefits the mucosa. The oral cavity presents a model of host-bacterial interactions at mucosal surfaces, in which a panoply of microorganisms colonizes various niches in the oral cavity and creates complex multispecies biofilms that challenge the gingival tissues. This report details gene expression in apoptotic pathways that occur in oral mucosal tissues across the lifespan, using a nonhuman primate model.