Transcriptomic features of programmed and inflammatory cell death in gingival tissues.

Unlabelled: The local gingival tissue environment with homeostasis and tissue-destructive events of periodontitis demonstrates major changes in histological features and biology of the oral/sulcular epithelium, fibroblasts, vascular cells, inflammatory cell infiltration, and alveolar bone.

Objective: This study used an experimental periodontitis model to detail the gingival transcriptome related to cell death processes of pyroptosis, necroptosis, ferroptosis, and cuproptosis.

Materials And Methods: Healthy Macaca mulatta primates stratified by age, ≤3 years (young), 7-12 years (adolescent), 12-15 years (adult), and 17-23 years (aged), provided gingival tissue biopsies for microarray analysis focused on 257 genes representative of the four cell death processes and bacterial plaque samples for 16S rRNA gene analysis.

Sex effects on gingival transcriptomic patterns during initiation, progression, and resolution of periodontitis.

Background: The prevalence and severity of periodontitis demonstrates altered population distribution with age, sex, and race and ethnicity. While males exhibit greater frequency of disease, particularly with aging, the underlying basis for this observation remains obscure.

Objective: This study used a nonhuman primate (Macaca mulatta) model of experimental ligature-induced periodontitis in adult animals to evaluate gingival transcriptomic differences stratified based upon sex of the animal.

Gingival transcriptomic patterns of macrophage polarization during initiation, progression, and resolution of periodontitis.

Phenotypic and functional heterogeneity of macrophages is clearly a critical component of their effective functions in innate and adaptive immunity. This investigation hypothesized that altered profiles of gene expression in gingival tissues in health, disease, and resolution would reflect changes in macrophage phenotypes occurring in these tissues. The study used a nonhuman primate model to evaluate gene expression profiles as footprints of macrophage variation using a longitudinal experimental model of ligature-induced periodontitis in animals from 3 to 23 years of age to identify aging effects on the gingival environment.

Mucosal circadian rhythm pathway genes altered by aging and periodontitis.

Unlabelled: As circadian processes can impact the immune system and are affected by infections and inflammation, this study examined the expression of circadian rhythm genes in periodontitis.

Methods: Macaca mulatta were used with naturally-occurring and ligature-induced periodontitis. Gingival tissue samples were obtained from healthy, diseased, and resolved sites in four groups: young (≤3 years), adolescent (3-7 years), adult (12-26) and aged (18-23 years).

Comparative Analysis of Gene Expression Patterns for Oral Epithelial Cell Functions in Periodontitis.

The structure and function of epithelial cells are critical for the construction and maintenance of intact epithelial surfaces throughout the body. Beyond the mechanical barrier functions, epithelial cells have been identified as active participants in providing warning signals to the host immune and inflammatory cells and in communicating various detailed information on the noxious challenge to help drive specificity in the characteristics of the host response related to health or pathologic inflammation. Rhesus monkeys were used in these studies to evaluate the gingival transcriptome for naturally occurring disease samples (GeneChip® Rhesus Macaque Genome Array) or for ligature-induced disease (GeneChip® Rhesus Gene 1.

Immunoglobulin gene expression profiles and microbiome characteristics in periodontitis in nonhuman primates.

Colonization of mucosal tissues throughout the body occurs by a wide array of bacteria in the microbiome that stimulate the cells and tissues, as well as respond to changes in the local milieu. A feature of periodontitis is the detection of adaptive immune responses to members of the oral microbiome that show specificity and changes with disease and treatment. Thus, variations in antibody responses are noted across the population and affected by aging, albeit, data are still unclear as to how these differences relate to disease risk and expression.

Gingival tissue antibody gene utilization in aging and periodontitis.

Objective: This study used a nonhuman primate model of ligature-induced periodontitis to document the characteristics of immunoglobulin (Ig) gene usage in gingival tissues with disease and affected by age.

Background: Adaptive immune responses to an array of oral bacteria are routinely detected in local gingival tissues and the systemic circulation across the human population. The level and diversity of antibody increases with periodontitis, reflecting the increased quantity of B cells and plasmacytes in the tissues at sites of periodontal lesions.

Gingival Transcriptome of Innate Antimicrobial Factors and the Oral Microbiome With Aging and Periodontitis.

The epithelial barrier at mucosal sites comprises an important mechanical protective feature of innate immunity, and is intimately involved in communicating signals of infection/tissue damage to inflammatory and immune cells in these local environments. A wide array of antimicrobial factors (AMF) exist at mucosal sites and in secretions that contribute to this innate immunity. A non-human primate model of ligature-induced periodontitis was used to explore characteristics of the antimicrobial factor transcriptome ( = 114 genes) of gingival biopsies in health, initiation and progression of periodontal lesions, and in samples with clinical resolution.

-Induced miRNAs Regulate CCL20 Responses in Human Oral Epithelial Cells.

The mechanisms through which oral commensal bacteria mitigates uncontrolled inflammatory responses of the oral mucosa remain unknown. Here, we show that representative oral bacterial species normally associated with oral health [S. gordonii (), V.

Oral Microbiome and Gingival Gene Expression of Inflammatory Biomolecules With Aging and Periodontitis.

Although data describe the presence and increase of inflammatory mediators in the local environment in periodontitis vs. health in humans, details regarding how these responses evolve in the transition from health to disease, changes during disease progression, and features of a resolved lesion remain unknown. This study used a nonhuman primate model of ligature-induced periodontitis in young, adolescent, adult, and aged animals to document features of inflammatory response affected by age.

: where do we stand in our battle against this oral pathogen?

Periodontal diseases, such as gingivitis and periodontitis, are inflammatory diseases triggered by pathogenic bacteria that lead to damage of the soft tissue and bone supporting the teeth. Amongst the identified oral periodontopathogenic bacteria, is able to enhance oral dysbiosis, which is an imbalance in the beneficial commensal and periodontal pathogenic bacteria that induces chronic inflammation. Given the critical role of oral pathogenic bacteria like in the pathogenesis of periodontitis, local and/or systemic antibacterial therapy has been suggested to treat this disease, especially in its severe or refractory forms.

Transcriptomic phases of periodontitis lesions using the nonhuman primate model.

We used a nonhuman primate model of ligature-induced periodontitis to identify patterns of gingival transcriptomic after changes demarcating phases of periodontitis lesions (initiation, progression, resolution). A total of 18 adult Macaca mulatta (12-22 years) had ligatures placed (premolar, 1st molar teeth) in all 4 quadrants. Gingival tissue samples were obtained (baseline, 2 weeks, 1 and 3 months during periodontitis and at 5 months resolution).

Oral microbiome interactions with gingival gene expression patterns for apoptosis, autophagy and hypoxia pathways in progressing periodontitis.

Oral mucosal tissues must react with and respond to microbes comprising the oral microbiome ecology. This study examined the interaction of the microbiome with transcriptomic footprints of apoptosis, autophagy and hypoxia pathways during periodontitis. Adult Macaca mulatta (n = 18; 12-23 years of age) exhibiting a healthy periodontium at baseline were used to induce progressing periodontitis through ligature placement around premolar/molar teeth.

Oral Microbiome and Gingival Tissue Apoptosis and Autophagy Transcriptomics.

This study focused on documenting characteristics of the gingival transcriptome during various stages of periodontitis targeting genes associated with apoptotic and autophagic pathways and changes that specifically associate with features of the oral microbiome. ( = 18; 12-23 years) were examined at baseline and 0.5, 1, and 3 months of disease progression, as well as 5 months with clinical disease resolution.

Oral commensal bacteria differentially modulate epithelial cell death.

Objective: Epithelial cell death is an important innate mechanism at mucosal surfaces, which enables the elimination of pathogens and modulates immunoinflammatory responses. Based on the antimicrobial and anti-inflammatory properties of cell death, we hypothesized that oral epithelial cell (OECs) death is differentially modulated by oral bacteria.

Material And Methods: We evaluated the effect of oral commensals Streptococcus gordonii (Sg), Streptococcus sanguinis (Ss), and Veillonella parvula (Vp), and pathogens Porphyromonas gingivalis (Pg), Tannerella forsythia (Tf), and Fusobacterium nucleatum (Fn) on OEC death.

Second Generation of Zafirlukast Derivatives with Improved Activity against the Oral Pathogen .

is a Gram-negative anaerobic pathogen that can trigger oral dysbiosis as an early event in the pathogenesis of periodontal disease. The FDA-approved drug zafirlukast (ZAF) was recently shown to display antibacterial activity against . Here, 15 novel ZAF derivatives were synthesized and evaluated for their antibacterial activity against and for their cytotoxic effects.

Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

Objective: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease.

Background: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection.

Methods: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis.

A Potential Role of Phospholipase 2 Group IIA (PLA-IIA) in P. gingivalis-Induced Oral Dysbiosis.

Porphyromonas gingivalis is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which P. gingivalis could abrogate the host-microbe symbiotic relationship leading to oral dysbiosis remain unclear.

Novel zafirlukast derivatives exhibit selective antibacterial activity against .

Periodontal disease is an oral chronic immune-inflammatory disease highly prevalent worldwide that is initiated by specific oral bacterial species leading to local and systemic effects. The development of new preventive/therapeutic strategies to specifically target oral periodontopathogens without perturbing oral microbiome species normally colonizing the oral cavity is needed. The fast and affordable strategy of repositioning of already FDA-approved drugs can be an answer to the development of novel treatments against periodontal pathogens such as .

Microbiome Profiles of Ligature-Induced Periodontitis in Nonhuman Primates across the Life Span.

This investigation compared the microbiomes colonizing teeth during the initiation, progression, and resolution of periodontitis in nonhuman primates () at different ages. Subgingival plaque samples were collected at baseline; 0.5, 1, and 3 months following ligature-induced periodontitis; and following naturally occurring disease resolution at 5 months.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Biofilm-induced profiles of immune response gene expression by oral epithelial cells.

This study examined the oral epithelial immunotranscriptome response patterns modulated by oral bacterial planktonic or biofilm challenge. We assessed gene expression patterns when epithelial cells were challenged with a multispecies biofilm composed of Streptococcus gordonii, Fusobacterium nucleatum, and Porphyromonas gingivalis representing a type of periodontopathic biofilm compared to challenge with the same species of planktonic bacteria. Of the 579 human immunology genes, a substantial signal of the epithelial cells was observed to 181 genes.

Periodontal disease susceptible matrilines in the Cayo Santiago Macaca mulatta macaques.

Objective And Background: The expression of periodontitis, including age of onset, extent, and severity is considered to represent an interaction of the individual's oral microbiome and host response to the microbial challenge that is modified by both genetics and environmental factors. The aim of this study was to determine the distribution of periodontitis in a population of nonhuman primates, to document features of familial distribution that could reflect heritability and transmission of microbes with enhanced virulence.

Material And Methods: This report presents our findings from evaluation of periodontal disease bone defects in skulls from 569 animals (5-31 years of age) derived from the skeletons of the rhesus monkeys (Macaca mulatta) of Cayo Santiago derived from eight matrilines over 6-9 generations.

Odontogenic abscesses in rhesus macaques (Macaca mulatta) of Cayo Santiago.

Objectives: Odontogenic abscesses are one of the most common dental diseases causing maxillofacial skeletal lesions. They affect the individual's ability to maintain the dental structures necessary to obtain adequate nutrition for survival and reproduction. In this study, the prevalence and pattern of odontogenic abscesses in relation to age, sex, matriline, and living periods were investigated in adult rhesus macaque skeletons of the free-ranging colony on Cayo Santiago, Puerto Rico.

Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates.

Background: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and 16 NP receptors (NPRs) coincident with the initiation, progression, and resolution of periodontitis were determined.