Exposure to oxygenated polycyclic aromatic hydrocarbons and endocrine dysfunction: Multi-level study based on hormone receptor responses.

Oxygenated polycyclic aromatic hydrocarbons (OPAHs) are a class of emerging environmental contaminants that exhibit high toxicity compared to parent PAHs. In addition to carcinogenic, teratogenic and mutagenic effects, recent studies show their potential to cause endocrine disruption, but the reports are controversial. In this study, we employed hormone receptors (ERα/AR/GRα/TRβ)-mediated dual luciferase reporter gene assay and molecular docking, and found that five typical OPAHs exhibited agonistic activity towards hormone receptors, and hydrogen bonding and hydrophobic interactions were the primary binding forces involved in OPAHs-receptor interactions.

Phenanthrene perturbs hematopoietic development and causes hematopoietic defects in zebrafish.

Phenanthrene (Phe) is one of the common polycyclic aromatic hydrocarbons in the environment, and recent studies show that it can cause cardiac developmental toxicity and immunotoxicity. However, it is still unknown whether it can affect the hematopoietic development in aquatic organisms. To address this question, zebrafish (Danio rerio) were chronically exposed to Phe at different concentrations.

Metastatic effects of hydroxy-polycyclic aromatic hydrocarbons on liver cancer cells mediated by estrogen receptor α.

Hydroxy-polycyclic aromatic hydrocarbons (OH-PAHs) are a growing worldwide concern because of their persistence, ubiquity, and toxicity. Nonetheless, research on the toxicological mechanisms of OH-PAHs remains sparse, particularly concerning the risk of liver cancer. This study evaluated the effects of OH-PAHs on disrupting estrogen receptor α (ERα) and subsequently facilitating hepatocellular invasion and metastasis.

Cross-Omics Analyses Reveal the Effects of Ambient PM Exposure on Hepatic Metabolism in Female Mice.

Ambient particulate matter (PM) is a potential risk factor for metabolic damage to the liver. Epidemiological studies suggest that elevated PM concentrations cause changes in hepatic metabolism, but there is a lack of laboratory evidence. Here, we aimed to evaluate the effects of PM exposure on liver metabolism in C57BL/6j female mice (10 months old) and to explore the mechanisms underlying metabolic alterations and differential gene expressions by combining metabolomics and transcriptomics analyses.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly.

Ozone induced multigenerational glucose and lipid metabolism disorders in Drosophila.

Ozone (O), a persistent pollutant, poses a significant health threat. However, research on its multigenerational toxicity remains limited. Leveraging the Drosophila model with its short lifespan and advanced genetic tools, we explored the effects of O exposure across three generations of fruit flies.

Retinal Degeneration Response to Graphene Quantum Dots: Disruption of the Blood-Retina Barrier Modulated by Surface Modification-Dependent DNA Methylation.

Graphene quantum dots (GQDs) are used in diverse fields from chemistry-related materials to biomedicines, thus causing their substantial release into the environment. Appropriate visual function is crucial for facilitating the decision-making process within the nervous system. Given the direct interaction of eyes with the environment and even nanoparticles, herein, GQDs, sulfonic acid-doped GQDs (S-GQDs), and amino-functionalized GQDs (A-GQDs) were employed to understand the potential optic neurotoxicity disruption mechanism by GQDs.

YTHDC2 mediated RNA mA modification contributes to PM-induced hepatic steatosis.

Exposure to fine particulate matter (PM) is a significant risk factor for hepatic steatosis. The N-methyladenosine (mA) is implicated in metabolic disturbances triggered by exogenous environmental factors. However, the role of mA in mediating PM-induced hepatic steatosis remains unclear.

Screening Organic Components and Toxicogenic Structures from Regional Fine Particulate Matters Responsible for Myocardial Fibrosis in Male Mice.

Numerous studies indicate that fine particulate matters (PM) and its organic components are urgent risk factors for cardiovascular diseases (CVDs). Combining toxicological experiments, effect-directed analyses, and nontarget identification, this study aims to explore whether PM exposure in coal-combustion areas induces myocardial fibrosis and how to identify the effective organic components and their toxic structures to support regional risk control. First, we constructed an animal model of real-world PM exposure during the heating season and found that the exposure impaired cardiac systolic function and caused myocardial fibrosis, with chemokine Ccl2-mediated inflammatory response being the key cause of collagen deposition.

Fetal Origin of Abnormal Glucose Tolerance in Adult Offspring Induced by Maternal Bisphenol A Analogs Exposure.

With the widespread use of bisphenol A (BPA) analogs, their health risks have attracted attention. The effects of maternal BPA analogs exposure on glucose homeostasis in adult offspring and the underlying fetal origins require further exploration. Herein, we exposed pregnant mice to two types of BPA analogs─BPB and BPAF; we evaluated glucose homeostasis in adult offspring and maternal-fetal glucose transport by testing intraperitoneal glucose tolerance, determining glucose and glycogen contents, conducting positron emission tomography (PET)/computed tomography (CT), detecting expression of placental nutrient transport factors, and assessing placental barrier status.

Multilevel Screening Strategy to Identify the Hydrophobic Organic Components of Ambient PM Associated with Hepatocellular Steatosis.

Hepatic steatosis is the first step in a series of events that drives hepatic disease and has been considerably associated with exposure to fine particulate matter (PM). Although the chemical constituents of particles matter in the negative health effects, the specific components of PM that trigger hepatic steatosis remain unclear. New strategies prioritizing the identification of the key components with the highest potential to cause adverse effects among the numerous components of PM are needed.

PM exposure contributes to anxiety and depression-like behaviors via phenyl-containing compounds interfering with dopamine receptor.

As a global problem, fine particulate matter (PM) really needs local fixes. Considering the increasing epidemiological relevance to anxiety and depression but inconsistent toxicological results, the most important question is to clarify whether and how PM causally contributes to these mental disorders and which components are the most dangerous for crucial mitigation in a particular place. In the present study, we chronically subjected male mice to a real-world PM exposure system throughout the winter heating period in a coal combustion area and revealed that PM caused anxiety and depression-like behaviors in adults such as restricted activity, diminished exploratory interest, enhanced repetitive stereotypy, and elevated acquired immobility, through behavioral tests including open field, elevated plus maze, marble-burying, and forced swimming tests.

Diel variations of airborne microbes and antibiotic resistance genes in Response to urban PM chemical properties during the heating season.

Among the components of fine particulate matter (PM), the contributions of airborne microorganisms and antibiotic resistance genes (ARGs) to health risks have been overlooked. Airborne microbial dynamics exhibit a unique diurnal cycle due to environmental influences. However, the specific roles of PM chemical properties resulting from fossil fuel combustion in driving circadian fluctuations in microbial populations and ARGs remain unclear.

Developmental Toxicity of Fine Particulate Matter: Multifaceted Exploration from Epidemiological and Laboratory Perspectives.

Particulate matter of size ≤ 2.5 μm (PM) is a critical environmental threat that considerably contributes to the global disease burden. However, accompanied by the rapid research progress in this field, the existing research on developmental toxicity is still constrained by limited data sources, varying quality, and insufficient in-depth mechanistic analysis.

Endocrine disrupting effects of parabens in zebrafish (Danio rerio): New insights from transcriptomics, metabolomics, and molecular dynamics simulation.

Parabens (PBs), a group of widely used synthetic preservatives with potential endocrine disrupting activity, have been detected with increasing frequency in organisms and environmental matrices. This study assessed the hormone interference effects of four typical PBs, namely methylparaben (MeP), ethylparaben (EtP), propylparaben (PrP), and butylparaben (BuP), in zebrafish and elucidated the probable underlying mechanisms. Transcriptomic and metabolomic analyses showed that the differentially expressed genes and metabolites were associated with the tyrosine metabolism, arachidonate metabolism, and glycerophospholipid metabolism, indicating they were essential precursors of steroid hormone biosynthesis and metabolism.

Mixed Metal Components in PM Contribute to Chemokine Receptor CCR5-Mediated Neuroinflammation and Neuropathological Changes in the Mouse Olfactory Bulb.

Particulate matter, especially PM, can invade the central nervous system (CNS) the olfactory pathway to induce neurotoxicity. The olfactory bulb (OB) is the key component integrating immunoprotection and olfaction processing and is necessarily involved in the relevant CNS health outcomes. Here we show that a microglial chemokine receptor, CCR5, is the target of environmentally relevant PM in the OB to trigger neuroinflammation and then neuropathological injuries.

Nontargeted Identification of Organic Components in Fine Particulate Matter Related to Lung Tumor Metastasis Based on an Adverse Outcome Pathway Strategy.

Emerging studies implicate fine particulate matter (PM) and its organic components (OCs) as urgent hazard factors for lung cancer progression in nonsmokers. Establishing the adverse outcome pathway (AOP)-directed nontargeted identification method, this study aimed to explore whether PM exposure in coal-burning areas promoted lung tumor metastasis and how we identify its effective OCs to support traceability and control of regional PM pollution. First, we used a nude mouse model of lung cancer for PM exposure and found that the exposure significantly promoted the hematogenous metastases of A549-Luc cells in lung tissues and the adverse outcomes (AOs), with key events (KEs) including the changed expression of epithelial-mesenchymal transition (EMT) markers, such as suppression of E-cad and increased expression of Fib.

Lung injuries induced by ozone exposure in female mice: Potential roles of the gut and lung microbes.

Ozone (O) is one of the most harmful pollutants affecting health. However, the potential effects of O exposure on microbes in the gut-lung axis related to lung injuries remain elusive. In this study, female mice were exposed to 0-, 0.

Invisible Hand behind Female Reproductive Disorders: Bisphenols, Recent Evidence and Future Perspectives.

Reproductive disorders are considered a global health problem influenced by physiological, genetic, environmental, and lifestyle factors. The increased exposure to bisphenols, a chemical used in large quantities for the production of polycarbonate plastics, has raised concerns regarding health risks in humans, particularly their endocrine-disrupting effects on female reproductive health. To provide a basis for future research on environmental interference and reproductive health, we reviewed relevant studies on the exposure patterns and levels of bisphenols in environmental matrices and humans (including susceptible populations such as pregnant women and children).