A potent broad-spectrum protective human monoclonal antibody crosslinking two haemagglutinin monomers of influenza A virus.

Effective annual influenza vaccination requires frequent changes in vaccine composition due to both antigenic shift for different subtype hemagglutinins (HAs) and antigenic drift in a particular HA. Here we present a broadly neutralizing human monoclonal antibody with an unusual binding modality. The antibody, designated CT149, was isolated from convalescent patients infected with pandemic H1N1 in 2009.

Effect of glucose feeding on the glycosylation quality of antibody produced by a human cell line, F2N78, in fed-batch culture.

The human cell line rF2N78 produces an antibody with a high galactosylation ratio which resembles human IgG. However, it has been observed that the aglycosylated antibody starts to appear when glucose is depleted. To determine whether glucose depletion is a main cause for aglycosylation of the antibody, fed-batch cultures of rF2N78 cells were performed using different feeding cocktails (glucose only, nutrient feeding cocktail without glucose, and nutrient feeding cocktail with glucose).

Application of a new human cell line, F2N78, in the transient and stable production of recombinant therapeutics.

Host cell lines developed by genetic engineering sometimes show instabilities in maintaining their genetically acquired phenotypes. Previously, a hybrid host cell line, designated as hybrid of kidney and B cells (HKB), capable of retaining selected phenotypes originally existing in the parental cells was developed via fusion of 293 cells and HH514-16 cells. Although HKB did indeed successfully preserve several favorable phenotypes, the expression of Epstein-Barr virus (EBV) specific nuclear antigen 1 (EBNA1), which should be constitutively expressed for host cells to utilize oriP expression vector in transient production of therapeutic proteins, was observed to be unstable.

Antifibrotic effects of a tissue inhibitor of metalloproteinase-1 antibody on established liver fibrosis in rats.

Liver fibrosis is characterized by increased synthesis, and decreased degradation, of extracellular matrix (ECM) within the injured tissue. Decreased ECM degradation results, in part, from increased expression of tissue inhibitor of metalloproteinase-1 (TIMP-1), which blocks matrix metalloproteinase (MMP) activity. TIMP-1 is also involved in promoting survival of activated hepatic stellate cells (HSCs), a major source of ECM.

Disruption of Epstein-Barr virus latency in the absence of phosphorylation of ZEBRA by protein kinase C.

ZEBRA protein converts Epstein-Barr virus (EBV) infection from the latent to the lytic state. The ability of ZEBRA to activate this switch is strictly dependent on the presence of serine or threonine at residue 186 of the protein (A. Francis, T.

Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements.

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins.