Reliable recognition of DNA methylation using bioanalysis of hybridization on the surface of Ag/GQD nanocomposite stabilized on poly (β-cyclodextrin): A new platform for DNA damage studies using genosensor technology.

Due to the role of DNA methylation in causing cancer in the present study, an innovative and inexpensive method was designed for the sensitive detection of DNA methylation. The silver-graphene quantum dots (Ag/GQDs) nano ink with high electrical conductivity was used as a substrate for genosensor fabrication toward identification of DNA hybridization. Also, poly (β-cyclodextrin) (p[β-CD]) has been used as a biointerface for the stabilization of Ag/GQD nano ink.

Identification of DNA methylation by novel optical genosensing: A new platform in epigenetic study using biomedical analysis.

Due to the important role of methylation in cancer, the use of sensitive analytical methods for early diagnosis and efficient clinical pharmacotherapy is highly demanded. In this study, an innovative label-free method has been developed for the recognition of methylated DNA in the promoter area of adenomatous polyposis coli gene (APC gene). Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA) was performed using optical synthesized probe (thionine-based polymer).

Application of lateral flow and microfluidic bio-assay and biosensing towards identification of DNA-methylation and cancer detection: Recent progress and challenges in biomedicine.

DNA methylation is an important epigenetic alteration that results from the covalent transfer of a methyl group to the fifth carbon of a cytosine residue in CpG dinucleotides by DNA methyltransferase. This modification mostly happens in the promoter region and the first exon of most genes and suppresses gene expression. Therefore, aberrant DNA methylation cause tumor progression, metastasis, and resistance to current anti-cancer therapies.