Colorimetric sensor array for versatile detection and discrimination of model analytes with environmental relevance.

In the current work, a rapid, simple, low-cost, and sensitive smartphone-based colorimetric sensor array coupled with pattern-recognition methods was proposed for the determination and differentiation of some organic and inorganic bases (i.e., OH, CO, PO, NH, ClO, diethanolamine, triethanolamine) as model compounds.

Fluorimetric detection of DNA methylation by cerium oxide nanoparticles for early cancer diagnosis.

In this study, a very sensitive fluorescence nano-biosensor was developed using CeO nanoparticles for the rapid detection of DNA methylation. The characteristics of CeO nanoparticles were determined by transmission electron microscopy (TEM), scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), X-ray diffraction (XRD) spectroscopy, UV-visible spectroscopy, and fluorescence spectroscopy. The CeO nanoparticles were reacted with a single-stranded DNA (ssDNA) probe, and then methylated and unmethylated target DNAs hybridized with an ssDNA probe, and the fluorescence emission was measured.

Iron/iron oxide-based magneto-electrochemical sensors/biosensors for ensuring food safety: recent progress and challenges in environmental protection.

Foodborne diseases have arisen due to the globalization of industry and the increase in urban population, which has led to increased demand for food and has ultimately endangered the quality of food. Foodborne diseases have caused some of the most common public health problems and led to significant social and economic issues worldwide. Food quality and safety are affected by microbial contaminants, growth-promoting feed additives (β-agonists and antibiotics), food allergens, and toxins in different stages from harvesting to storage and marketing of products.

Optical bio-sensing of DNA methylation analysis: an overview of recent progress and future prospects.

DNA methylation as one of the most important epigenetic modifications has a critical role in regulating gene expression and drug resistance in treating diseases such as cancer. Therefore, the detection of DNA methylation in the early stages of cancer plays an essential role in disease diagnosis. The majority of routine methods to detect DNA methylation are very tedious and costly.

Microfluidic assisted recognition of miRNAs towards point-of-care diagnosis: Technical and analytical overview towards biosensing of short stranded single non-coding oligonucleotides.

MiRNAs are short stranded single non-coding oligonucleotides that play an important role in regulating gene expression. MiRNAs are stable in RNase enriched environments such as human body fluids and their dysregulation or abnormal abundance in human body fluids as a diagnostic biomarker has been associated with several diseases. Due to the low concentration of miRNAs, it is difficult to detect using interactive methods (ideal detection limit is femtomolar range).

An innovative fluorometric bioanalysis strategy towards recognition of DNA methylation using opto-active polymer: A new platform for DNA damage studies by genosensor technology.

Efficient pharmacotherapy of cancer is related to accurate recognition of genetic mutations and epigenetic alterations in the early-stage diagnosis. In the present study, a novel optical genosensor based on toluidine blue as photonic probe was developed to detection of DNA methylation using hybridization of pDNA with cDNA. Biomedical analysis was performed using UV-vis and fluorometric methods.

Reliable recognition of DNA methylation using bioanalysis of hybridization on the surface of Ag/GQD nanocomposite stabilized on poly (β-cyclodextrin): A new platform for DNA damage studies using genosensor technology.

Due to the role of DNA methylation in causing cancer in the present study, an innovative and inexpensive method was designed for the sensitive detection of DNA methylation. The silver-graphene quantum dots (Ag/GQDs) nano ink with high electrical conductivity was used as a substrate for genosensor fabrication toward identification of DNA hybridization. Also, poly (β-cyclodextrin) (p[β-CD]) has been used as a biointerface for the stabilization of Ag/GQD nano ink.

Identification of DNA methylation by novel optical genosensing: A new platform in epigenetic study using biomedical analysis.

Due to the important role of methylation in cancer, the use of sensitive analytical methods for early diagnosis and efficient clinical pharmacotherapy is highly demanded. In this study, an innovative label-free method has been developed for the recognition of methylated DNA in the promoter area of adenomatous polyposis coli gene (APC gene). Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA) was performed using optical synthesized probe (thionine-based polymer).

Application of lateral flow and microfluidic bio-assay and biosensing towards identification of DNA-methylation and cancer detection: Recent progress and challenges in biomedicine.

DNA methylation is an important epigenetic alteration that results from the covalent transfer of a methyl group to the fifth carbon of a cytosine residue in CpG dinucleotides by DNA methyltransferase. This modification mostly happens in the promoter region and the first exon of most genes and suppresses gene expression. Therefore, aberrant DNA methylation cause tumor progression, metastasis, and resistance to current anti-cancer therapies.

The TP53 intron 6 G13964C polymorphism and risk of thyroid and breast cancer development in the Iranian Azeri population.

Background: TP53 mutations are the most common genetic alterations in human cancers. There are also several polymorphisms in both exons and introns of TP53 that may influence its anti-tumor functions and increase the risk of cancer development. Associations of the TP53 intron 6 G13964C polymorphism with increased risk of development of several cancers have been investigated in numerous studies, but the results were controversial and conflicting.