Publications by authors named "Marzieh Ajamgard"

The adsorption process of three aptamers with gold nanosheet (GNS) as a drug carrier has been investigated with the help of molecular dynamics simulations. The sequencing of the considered aptamers are as (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU) and (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) for AP1 and AP2, respectively. AP3 is a muted version of AP1 in which nucleotide positions 4, 6, 18, 28 and 39 have C4A, U6G, A18G, G28A, and U39C mutations.

View Article and Find Full Text PDF

Alpha-Synuclein (αS) is a protein involved in Parkinson's disease (PD) and is probably the main cause of the pathology of the disease. During pathogenesis, αS monomers aggregate, leading to the formation of a variety of oligomeric species. Recent research studies suggest that the oligomeric toxic species may be one of the main processes for pathology and disease.

View Article and Find Full Text PDF