Genetic Diversity, Reassortment, and Recombination in Alfalfa mosaic virus Population in Spain.

The variability and genetic structure of Alfalfa mosaic virus (AMV) in Spain was evaluated through the molecular characterization of 60 isolates collected from different hosts and different geographic areas. Analysis of nucleotide sequences in four coding regions--P1, P2, movement protein (MP), and coat protein (CP)--revealed a low genetic diversity and different restrictions to variation operating on each coding region. Phylogenetic analysis of Spanish isolates along with previously reported AMV sequences showed consistent clustering into types I and II for P1 and types I, IIA, and IIB for MP and CP regions.

Genetic variability and evolution of broad bean wilt virus 1: role of recombination, selection and gene flow.

Analysis of four genomic regions from 37 geographically diverse isolates of broad bean wilt virus 1 (BBWV-1) showed high genetic diversity in comparison to most plant viruses. Comparison of synonymous and nonsynonymous substitutions of the small coat protein gene (SCP) revealed negative selection for most amino acid positions. Phylogenetic analysis of SCP showed that some BBWV-1 isolates from distant geographical areas were genetically close, suggesting long-distance migration.

Genetic variability and evolutionary analyses of the coat protein gene of Tomato mosaic virus.

Tomato mosaic virus (ToMV), a member of the genus Tobamovirus, infects several ornamental and horticultural crops worldwide. In this study, the nucleotide sequences of the coat protein gene of worldwide ToMV isolates were analyzed to estimate the genetic structure and diversity of this virus and the involved evolutionary forces. The phylogenetic analysis showed three clades with high bootstrap support: Clade I contained three ToMV isolates from Brazil collected from pepper, Clade II comprised one Brazilian ToMV isolate from pepper, and Clade III was composed of ToMV isolates collected from different plant hosts (pepper, tomato, eggplant, lilac, camellia, dogwood, red spruce, etc.

First Report of Pepper as a Natural Host for Pelargonium zonate spot virus in Spain.

Pelargonium zonate spot virus (PZSV) was first reported on Pelargonium zonale (L.) L'Hér. ex Aiton and later on tomato in Italy, Spain, France (1), and the United States (2).

New molecular methods for identification of broad bean wilt virus 1.

Broad bean wilt virus 1 (BBWV-1) causes damages in economically important plant crops such as pepper, bean, spinach, etc. Fast, cheap and reliable diagnostic tools are crucial to limit or control the disease. In this work, tissue blot immunoassay (TBIA), dot-blot (DB) and tissue-print (TP)-hybridization were developed for BBWV-1 diagnosis and evaluated for sensitivity, specificity and reliability in plants of several host species grown in the greenhouse or in the field, in comparison with ELISA and RT-PCR.

Detection and identification of species of the genus Fabavirus by RT-PCR with a single pair of primers.

The genus Fabavirus includes three species: Broad bean wilt virus 1 (BBWV-1), BBWV-2 and Lamium mild mosaic virus (LMMV), but a new candidate species, Gentian mosaic virus (GeMV), has been proposed. Analysis of the complete nucleotide sequences of fabaviruses was used to design a pair of conserved primers for specific detection of members of this genus. These primers encompassed the 5'-terminal non-translatable region (NTR) , whose size for BBWV-1, BBWV-2 and GeMV was different.

The complete sequence of a Spanish isolate of Broad bean wilt virus 1 (BBWV-1) reveals a high variability and conserved motifs in the genus Fabavirus.

The genome of a Spanish isolate of Broad bean wilt virus-1 (BBWV-1) was completely sequenced and compared with available sequences of other isolates of the genus Fabavirus (BBWV-1 and BBWV-2). This consisted of two RNAs of 5814 and 3431 nucleotides, respectively, and their organization was similar to that of other members of the family Comoviridae. Its mean nucleotide identity with a BBWV-1 American isolate was 81.

Potential Sources of Resistance for Melon to Nonpersistently Aphid-borne Viruses.

Two hundred and sixty-eight Cucumis melo and wild relative accessions were evaluated for resistance to Cucumber mosaic virus (CMV), Papaya ringspot virus strain W (PRSV-W), Watermelon mosaic virus (WMV), and Zucchini yellow mosaic virus (ZYMV). Symptom development and systemic infection based on double antibody sandwich enzyme-linked immunosorbent assays were monitored. Sources of resistance were scarce.

Development of RAPD and SCAR markers linked to the Pvr4 locus for resistance to PVY in pepper ( Capsicum annuum L.).

Potato Virus Y (PVY) is the only potyvirus infecting pepper ( Capsicum annuum L.) in Europe. Currently, the development of pepper varieties resistant to PVY seems to be the most-efficient method to control PVY damage.

First Report of Broad bean wilt virus 1 in Spain.

In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No.

Natural Infection of Field-Grown Borage (Borago officinalis) by Alfalfa mosaic virus in Spain.

Alfalfa mosaic virus (AMV) has a wide host range and is distributed throughout the world. It causes disease in several vegetable crops, including bean, celery, lettuce, pea, pepper, and tomato (1). In Spain, it has been found naturally infecting alfalfa, pepper, and tomato.

First Report of Natural Infection of Greenhouse-Grown Tomato and Weed Species by Pelargonium zonate spot virus in Spain.

Tomato (Lycopersicon esculentum Mill.) plants showing severe chlorotic and necrotic ringspots, line patterns on leaves, and concentric chlorotic ringspots on stems and fruits were observed in plastic greenhouse-grown tomato crops cv. Royesta during the spring of 1996 in Zaragoza province, Northeast Spain.

Occurrence, Distribution, and Relative Incidence of Mosaic Viruses Infecting Field-Grown Melon in Spain.

The main areas for field-grown melon (Cucumis melo) production in Spain were surveyed for the occurrence and relative incidence of cucumber mosaic virus (CMV), papaya ringspot virus-watermelon strain (PRSV-W), watermelon mosaic virus-2 (WMV-2), and zucchini yellow mosaic virus (ZYMV) during the growing seasons of 1995 and 1996. Samples from 1,152 plants showing symptoms of virus infection were collected from commercial melon fields and analyzed by enzyme-linked immunosorbent assay (ELISA). CMV and WMV-2 were the most frequently found viruses, both by the number of locations and by their incidence in each location.