The volume changes of unfolding of dsDNA.

High hydrostatic pressure can have profound effects on the stability of biomacromolecules. The magnitude and direction (stabilizing or destabilizing) of this effect is defined by the volume changes in the system, ΔV. Positive volume changes will stabilize the starting native state, whereas negative volume changes will lead to the stabilization of the final unfolded state.

The human AP-endonuclease 1 (APE1) is a DNA G-quadruplex structure binding protein and regulates KRAS expression in pancreatic ductal adenocarcinoma cells.

Pancreatic ductal adenocarcinoma (PDAC), one of the most aggressive types of cancer, is characterized by aberrant activity of oncogenic KRAS. A nuclease-hypersensitive GC-rich region in KRAS promoter can fold into a four-stranded DNA secondary structure called G-quadruplex (G4), known to regulate KRAS expression. However, the factors that regulate stable G4 formation in the genome and KRAS expression in PDAC are largely unknown.

Thermodynamic investigation of kissing-loop interactions.

Kissing loop interactions (KLIs) are a common motif that is critical in retroviral dimerization, viroid replication, mRNA, and riboswitches. In addition, KLIs are currently used in a variety of biotechnology applications, such as in aptamer sensors, RNA scaffolds and to stabilize vaccines for therapeutics. Here we describe the thermodynamics of a basic intramolecular DNA capable of engaging in a KLI, consisting of two hairpins connected by a flexible linker.

Thermodynamic Stability of DNA Duplexes Comprising the Simplest T → dU Substitutions.

Members of the uracil-DNA glycosylase (UDG) enzyme family recognize and bind uracil, sequestering it within the binding site pocket and catalyzing the cleavage of the base from the deoxyribose, leaving an abasic site. The recognition and binding are passive and rely on innate dynamic motions of DNA wherein base pairs undergo thermally induced breakage and conformational fluctuations. Once the uracil breaks from its base pair, it can be recognized and bound by the enzyme, which then alters its conformation for sequestration and catalysis.

Energetics, Ion, and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

Triplex formation occurs via interaction of a third strand with the major groove of double-stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of polyadenylic acid (poly(rA))·polyuridylic acid (poly(rU)) (duplex) and poly(rA)·2poly(rU) (triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques.

Increased Flexibility between Stems of Intramolecular Three-Way Junctions by the Insertion of Bulges.

Intramolecular junctions are a ubiquitous structure within DNA and RNA; three-way junctions in particular have high strain around the junction because of the lack of flexibility, preventing the junctions from adopting conformations that would allow for optimal folding. In this work, we used a combination of calorimetric and spectroscopic techniques to study the unfolding of four intramolecular three-way junctions. The control three-way junction, 3H, has the sequence d(GAAATTGCGCTGCGCGTGCTGCACAATTTC), which has three arms of different sequences.

Effect of GCAA stabilizing loops on three- and four-way intramolecular junctions.

Tetraloops are a common way of changing the melting behavior of a DNA or RNA structure without changing the sequence of the stem. Because of the ubiquitous nature of tetraloops, our goal is to understand the effect a GCAA tetraloop, which belongs to the GNRA family of tetraloops, has on the unfolding thermodynamics of intramolecular junctions. Specifically, we have described the melting behavior of intramolecular three-way and four-way junctions where a T loop has been replaced with a GCAA tetraloops in different positions.

Effect of dC → d(mC) substitutions on the folding of intramolecular triplexes with mixed TAT and CGC base triplets.

Oligonucleotide-directed triple helix formation has been recognized as a potential tool for targeting genes with high specificity. Cystosine methylation in the 5' position is both ubiquitous and a stable regulatory modification, which could potentially stabilize triple helix formation. In this work, we have used a combination of calorimetric and spectroscopic techniques to study the intramolecular unfolding of four triplexes and two duplexes.

Unfolding and Targeting Thermodynamics of a DNA Intramolecular Complex with Joined Triplex-Duplex Domains.

Our laboratory is interested in developing methods that can be used for the control of gene expression. In this work, we are investigating the reaction of an intramolecular complex containing a triplex-duplex junction with partially complementary strands. We used a combination of isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectroscopy techniques to determine standard thermodynamic profiles for these targeting reactions.

Structural Insight into the Unbound State of the DNA Analogue of the PreQ Riboswitch: A Thermodynamic Approach.

The preQ riboswitch aptamer domain is very dynamic in its unbound state with the ability to form multiple structures: a hairpin, kissing hairpins, and pseudoknot-like structure. The aim of this study is to determine whether the DNA analogue (PreQ) is able to form structures similar to that of the reported RNA aptamer. Using a thermodynamic approach, we report on structural determination using differential scanning calorimetry under different salt conditions.

Melting Behavior of a DNA Four-Way Junction Using Spectroscopic and Calorimetric Techniques.

Intramolecular four-way junctions are structures present during homologous recombination, repair of double stranded DNA breaks, and integron recombination. Because of the wide range of biological processes four-way junctions are involved in, understanding how and under what conditions these structures form is critical. In this work, we used a combination of spectroscopic and calorimetric techniques to present a complete thermodynamic description of the unfolding of a DNA four-way junction (FWJ) and its appropriate control stem-loop motifs (Dumbbell, GAAATT-Hp, CTATC-Hp, GTGC-Hp, and GCGC-Hp).

Effect of Loop Length and Sequence on the Stability of DNA Pyrimidine Triplexes with TAT Base Triplets.

We report the thermodynamic contributions of loop length and loop sequence to the overall stability of DNA intramolecular pyrimidine triplexes. Two sets of triplexes were designed: in the first set, the C loop closing the triplex stem was replaced with CTC loops (n = 1-5), whereas in the second set, both the duplex and triplex loops were replaced with a GCAA or AACG tetraloop. For the triplexes with a CTC loop, the triplex with five bases in the loop has the highest stability relative to the control.

Investigation of the Melting Behavior of DNA Three-Way Junctions in the Closed and Open States.

Intramolecular three-way junctions are commonly found in both DNA and RNA. These structures are functionally relevant in ribozymes, riboswitches, rRNA, and during replication. In this work, we present a thermodynamic description of the unfolding of DNA intramolecular three-way junctions.

The Complementarity of the Loop to the Stem in DNA Pseudoknots Gives Rise to Local TAT Base-Triplets.

Pseudoknots belong to an RNA structural motif that has significant roles in the biological function of RNA. An example is ribosomal frameshifting; in this mechanism, the formation of a local triplex changes the reading frame that allows for differences in the translation of mRNAs. In this work, we have used a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry (DSC) to determine the unfolding thermodynamics of a set of DNA pseudoknots with the following sequence: d(TCTCTTnAAAAAAAAGAGAT5TTTTTTT), where "Tn" is a thymine loop with n=5 (PsK-5), 7 (PsK-7), 9 (PsK-9), or 11 (PsK-11).

Loop contributions to the folding thermodynamics of DNA straight hairpin loops and pseudoknots.

Pseudoknots have diverse and important roles in many biological functions. We used a combination of UV spectroscopy and differential scanning calorimetry to investigate the effect of the loop length on the unfolding thermodynamics of three sets of DNA stem-loop motifs with the following sequences: (a) d(GCGCTnGCGC), where n = 3, 5, 7, 9; (b) d(CGCGCGT4GAAATTCGCGCGTnAATTTC), where n = 4, 6, and 8; and (c) d(TCTCTTnAAAAAAAAGAGAT5TTTTTTT), where n = 5, 7, 9, and 11. The increase in loop length of the first set of hairpins yielded decreasing TM's and constant unfolding enthalpies, resulting in an entropy driven decrease in the stability of the hairpin (ΔG° = -7.

The size of the internal loop in DNA hairpins influences their targeting with partially complementary strands.

Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach.

Looking for Waldo: a potential thermodynamic signature to DNA damage.

DNA in its simplest form is an ensemble of nucleic acids, water, and ions, and the conformation of DNA is dependent on the relative proportions of all three components. When DNA is covalently damaged by endogenous or exogenous reactive species, including those produced by some anticancer drugs, the ensemble undergoes localized changes that affect nucleic acid structure, thermodynamic stability, and the qualitative and quantative arrangement of associated cations and water molecules. Fortunately, the biological effects of low levels of DNA damage are successfully mitigated by a large number of proteins that efficiently recognize and repair DNA damage in the midst of a vast excess of canonical DNA.

Probing the Temperature Unfolding of a Variety of DNA Secondary Structures Using the Fluorescence Properties of 2-aminopurine.

The fluorescence probe 2-aminopurine (2AP) is widely used to monitor the molecular environment, including the local solvent environment, and overall dynamics of nucleic acids and nucleic acid-ligand complexes. This work reports on the temperature-induced conformational flexibility of a variety of secondary structures of nucleic acids using optical and calorimetric melting techniques, and evaluates the usefulness of fluorescence melting curves obtained from monitoring the fluorescence changes of 2AP as a function of temperature. Furthermore, the base stacking properties of 2AP are examined in these structures for a first time.

The human ITPA polymorphic variant P32T is destabilized by the unpacking of the hydrophobic core.

Inosine triphosphate pyrophosphatase (ITPA), a key enzyme involved in maintaining the purity of cellular nucleoside triphosphate pools, specifically recognizes inosine triphosphate and xanthosine triphosphate (including the deoxyribose forms) and detoxifies them by catalyzing the hydrolysis of a phosphoanhydride bond, releasing pyrophosphate. This prevents their inappropriate use as substrates in enzymatic reactions utilizing (d)ATP or (d)GTP. A human genetic polymorphism leads to the substitution of Thr for Pro32 (P32T) and causes ITPA deficiency in erythrocytes, with heterozygotes having on average 22.

Thermodynamic profiles and nuclear magnetic resonance studies of oligonucleotide duplexes containing single diastereomeric spiroiminodihydantoin lesions.

The spiroiminodihydantoins (Sp) are highly mutagenic oxidation products of guanine and 8-oxo-7,8-dihydroguanine in DNA. The Sp lesions have recently been detected in the liver and colon of mice infected with Helicobacter hepaticus that induces inflammation and the development of liver and colon cancers in murine model systems [Mangerich, A., et al.

Prevention of orthopedic device-associated osteomyelitis using oxacillin-containing biomineral-binding liposomes.

Purpose: To develop novel biomineral-binding liposomes (BBL) for the prevention of orthopedic implant associated osteomyelitis.

Methods: A biomineral-binding lipid, alendronate-tri(ethyleneglycol)-cholesterol conjugate (ALN-TEG-Chol), was synthesized through Cu(I)-catalyzed Huisgen 1,3-dipolar cycloaddition (a versatile click reaction). Mixing with other excipients, the new lipid was used to develop BBL.

Rabankyrin-5 interacts with EHD1 and Vps26 to regulate endocytic trafficking and retromer function.

Rabankyrin-5 (Rank-5) has been implicated as an effector of the small GTPase Rab5 and plays an important role in macropinocytosis. We have now identified Rank-5 as an interaction partner for the recycling regulatory protein, Eps15 homology domain 1 (EHD1). We have demonstrated this interaction by glutathione S-transferase-pulldown, yeast two-hybrid assay, isothermal calorimetry and co-immunoprecipitation, and found that the binding occurs between the EH domain of EHD1 and the NPFED motif of Rank-5.