Publications by authors named "Louis Chonco"

Deer antlers are the fastest growing tissue. Because they are based on proto-oncogenes, to avoid the risk of cancer, antlers evolved strong anticancer mechanisms, and thus their extract (DVA) is effective also against the few human tumours studied so far. We assessed whether DVA is a general anticancer compound by testing the direct effects in cells of different tumours: glioblastoma (GBM; lines U87MG and U251), colorectal (CRC; lines DLD-1, HT-29, SW480, and SW620), breast cancer (BRCA; lines MCF7, SKBR3, and PA00), and leukaemia (THP-1).

View Article and Find Full Text PDF

In this study, we analysed the effect of human-mediated selection on the gene pool of wild and farmed red deer populations based on genotyping-by-sequencing data. The farmed red deer sample covered populations spread across seven countries and two continents (France, Germany, Hungary, Latvia, New Zealand, Poland, and Slovakia). The Slovak and Spain wild red deer populations (the latter one in a large game estate) were used as control outgroups.

View Article and Find Full Text PDF

Antlers are the only organ in the mammalian body that regenerates each year. They can reach growth rates of 1-3 cm/day in length and create more than 20 cm/day of skin in the antler tips (their growth centers). Previous proteomic studies regarding antlers have focused on antler growth centers (tips) compared to the standard bone to detect the proteins involved in tissue growth.

View Article and Find Full Text PDF

This study describes chemical, physical, microbiological and technological characteristics of red deer milk and the effect of lactation on these parameters in order to know their potential aptitude to elaborate dairy products. During 18 weeks, milk from five hinds was monitored for composition, bacteriology, somatic cell count (SCC), physical properties and rennet coagulation. Mean values (g/100 g) for fat, protein, lactose and dry matter were 10.

View Article and Find Full Text PDF

A recent study showed that antlers have evolved a high rate of growth due to the expression of proto-oncogenes and that they have also evolved to express several tumour suppressor genes to control the risk of cancer. This may explain why deer antler velvet (DAV) extract shows anti-tumour activity. The fast growth of antler innervation through the velvet in close association to blood vessels provides a unique environment to study the fast but non-cancerous proliferation of heterogeneous cell populations.

View Article and Find Full Text PDF

The chemokine (C-C motif) ligand 21 (CCL21) is a cytokine that attracts CCR7-positive cells to the T cell (paracortical) zone of lymph nodes by directional migration of these cells along the CCL21 gradient. In this article, we sought to mimic this chemotactic mechanism, by identifying a novel aptamer that binds CCL21 with high affinity. In vitro selection of DNA aptamers was performed by the Systematic Evolution of Ligands by Exponential Enrichment.

View Article and Find Full Text PDF

Background: Encapsidation, the process during which the genomic RNA of HIV is packaged into viral particles, is an attractive target for antiviral therapy. This study explores a novel nanotechnology-based strategy to inhibit HIV encapsidation by an RNA decoy mechanism. The design of the 16-mer oligoribonucleotide (RNA) decoy is based on the sequence of stem loop 3 (SL3) of the HIV packaging signal (Ψ).

View Article and Find Full Text PDF

Corona discharges are commonly utilized for numerous practical applications, including bio-technological ones. The corona induced transfer of normally impermeant molecules into the interior of biological cells has recently been successfully demonstrated. The exact nature of the interaction of the corona discharge with a cell membrane is still unknown, however, previous studies have suggested that it is either the electric fields produced by ions or the chemical interaction of the reactive species that result in the disruption of the cell membrane.

View Article and Find Full Text PDF

Assessment of toxicity is an important component of the drug discovery process. Cellbased assays are a popular choice for assessing cytotoxicity. However, these assays are complex because of the wide variety of formats and methods that are available, lack of standardization, confusing terminology and the inherent variability of biological systems and measurement.

View Article and Find Full Text PDF

We developed a NOD-Scid IL2rγ(null) mouse model transplanted with human skin that brings fundamental insight on in vivo cellular mechanisms of intradermal immunization and antigen presentation by dermal dendritic and epidermal Langerhans cells for skin T-cell immunity. Indeed, T-cell immunity is a crucial checkpoint for the induction of in vivo rapid control of skin infection. With the long-term preservation of a complete human skin immune system, this model offers the unique opportunity not only to better understand mechanisms of skin immune response but also to test new compounds and devices for cutaneous routes of vaccination, as well as new therapeutics approach for skin diseases, allergies or infections.

View Article and Find Full Text PDF

Anionic carbosilane dendrimers of generations 1-3 have been synthesized containing carboxylate G(n)X(C(2)H(4)CO(2)Na)(m) and sulfonate G(n)X(C(2)H(4)SO(3)Na)(m) peripheral groups and derived from two different cores, 1,3,5-(HO)(3)C(6)H(3) (X = O(3)) and Si(C(3)H(5))(4) (X = Si). The peripheral anionic groups make these dendrimers water soluble, despite their highly hydrophobic framework. These dendrimers present a net negative charge in water, which was influenced by the pH of the medium.

View Article and Find Full Text PDF

The ability of dendrimer 2G-[Si{O(CH(2))(2)N(Me)(2) (+)(CH(2))(2)NMe(3) (+)(I(-))(2)}](8) (NN16) to transfect a wide range of cell types, as well as the possible biomedical application in direct or indirect inhibition of HIV replication, was investigated. Cells implicated in HIV infection such as primary peripheral blood mononuclear cells (PBMC) and immortalized suspension cells (lymphocytes), primary macrophages and dendritic cells, and immortalized adherent cells (astrocytes and trophoblasts) were analyzed. Dendrimer toxicity was evaluated by mitochondrial activity, cell membrane rupture, release of lactate dehydrogenase, erythrocyte hemolysis, and the effect on global gene expression profiles using whole-genome human microarrays.

View Article and Find Full Text PDF

Dendrimers have been proposed as new carriers for drug delivery. They have distinctive characteristics, such as uniform and controlled size, monodispersity and modifiable surface group functionality, which make them extremely useful for biomedical applications. In this study, the binding capacity of water-soluble carbosilane dendrimers was examined.

View Article and Find Full Text PDF

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis.

View Article and Find Full Text PDF

Treatment of dendriplexes formed between water-soluble carbosilane dendrimers and phosphorothioate oligodeoxynucleotides (ODN) with the anionic detergent sodium dodecyl sulfate disrupted the complexes indicating that the nature of the union in such dendriplexes is merely electrostatic. However, dendriplexes were not dissociated by serum proteins like bovine or human serum albumins, as assessed by gel electrophoresis and fluorescence experiments. This would imply a dendrimer-mediated protective effect able to prevent ODN interactions with serum proteins and additionally could translate into a reduction of the ODN doses needed to achieve the biological effects.

View Article and Find Full Text PDF

Novel amine- or ammonium-terminated carbosilane dendrimers of type nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe2)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe2}]x and nG-[Si{(CH2)3NH2}]x or nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe3 +I-)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe3 +I-}]x, and nG-[Si{(CH2)3NH3 +Cl-}]x have been synthesized and characterized up to the third generation by two strategies: 1) alcoholysis of Si--Cl bonds with amino alcohols and subsequent quaternization with MeI, and 2) hydrosilylation of allylamine with Si--H bonds of the dendritic systems and subsequent quaternization with HCl. Quaternized carbosilane dendrimers are soluble in water, although degradation is apparent due to hydrolysis of Si--O bonds. However, dendrimers containing Si--C bonds are water-stable.

View Article and Find Full Text PDF