[Efficacy of oral drug Thrombovasim® in therapy of lower extremity deep vein thromboses].

Within the framework of the multicenter randomized placebo-controlled double-blind clinical trial "VETTER-1" the authors carried out assessment of therapeutic efficacy and safety of oral drug Thrombovasim® possessing a thrombolytic effect in comprehensive treatment of lower-extremity deep vein thrombosis (LEDVT). The clinical study comprised a total of 154 patients. All patients received standard therapy accepted in LEDVT.

[Recanalization of lower-limb deep veins as an index of efficacy of treatment for acute venous thrombosis].

The authors analysed the results of examination and treatment of a total of 102 patients presenting with iliofemoral venous thrombosis. During treatment, ultrasonographic duplex scanning was used to determine the localization of the proximal margin of thrombotic masses, the time of appearing of the first signs of recanalization, its degree at various levels of the deep venous system, as well as alteration in velocity of the venous blood flow in the deep veins of the lower limbs. The dynamics of clinical symptoms was assessed by the visual analogue scale.

[Clinical diagnosis and prognosis of pulmonary thromboembolism].

Pulmonary thromboembolism (PTE) is a nosological entity that complicates the course of many diseases. This circumstance determines difficulties in the diagnosis and determination of further patient management tactics. Bolus-enhanced computed tomography of pulmonary arteries, a method having high resolution and high accuracy, is presently accepted to be the gold standard to verify the diagnosis.

[How to validate the symptoms of pulmonary thromboembolism: how diagnostic scales help].

Aim: To detect the most important clinical symptoms suggesting pulmonary thromboembolism (PTE) and to determine the diagnostic value of the scales used to estimate the likelihood of its occurrence.

Materials And Methods: The prospective study included 130 patients admitted to hospital with a diagnosis of PTE and a referral for a surgery clinic. Scores of the likelihood of PTE were estimated using the Canada and Geneva scales in all the patients on admission.

[Warfarin or enoxaparin: the choice for the patient with venous thrombosis in the first month of treatment].

Aim: To compare efficacy and safety of warfarin and enoxaparin used in the first month of treatment of patients with an episode of deep vein thrombosis (DVT) and/or pulmonary artery thromboembolism (PATE).

Material And Methods: Sixty patients (34 males, 26 females, age 18-76 years) after the DVT/PATE episode were divided into two groups. Patients of group 1 received standard therapy (non-fractionated heparin -NFH followed by warfarin), patients of group 2 instead of NFH received enoxaparin (1 mg/kg each 12 hours for at least 30 days).

[Treatment of inferior vena cava thrombosis. How to avoid errors?].

Unsatisfactory results of acute thrombosis treatment in inferior vena cava system are attributed to inadequate diagnosis, poor compliance with approved clinical practice guidelines and secondary preventive measures, as well as to excessive adherence to surgical methods of pulmonary embolism prophylaxis. Diagnostic strategy, which combines compressive duplex scanning and D-dimer test, can improve diagnosis and reduce its cost. Various molecular weight heparins and vitamin K antagonists are still the main means of venous thrombosis therapy.

[Outpatient clinic facilities for clinical-laboratory diagnosis of hepatic fibrosis].

Aim: To compare fibrosis stages estimated by histological data obtained at biopsy of hepatic tissue with fibrosis index (FI) calculated with the dominant calculation scale (DCS); to define diagnostic thresholds, sensitivity and specificity of FI estimation.

Material And Methods: The trial included 75 chronic hepatitis (CH) patients (54 males and 21 females, mean age 37.4 +/- 9.

[C677T mutation in methylentetrahydrofolatereductase gene in patients with venous thromboses from the central region of Russia correlates with a high risk of pulmonary artery thromboembolism].

Aim: To investigate genetic factors of risk (RF) to develop venous thrombosis and pulmonary artery thromboembolism (PATE) in population of central Russia.

Material And Methods: We studied polymorphism of the genes of coagulation factor II (G20210A), factor V (G1691A) and methylentetrahydrofolatereductase (MTHFR) with polymerase chain reaction and restriction analysis of DNA amplified sites. We estimated prevalence of the mutations in healthy population and in patients with flebothrombosis as well as effects of the mutations on a PATE rate in patients with thrombosis.

[Antiphospholipid syndrome in the structure of hematogenic thrombophilia in young and middle-aged patients with venous thrombosis].

Aim: To specify detectability and clinical presentation of antiphospholipid syndrome (APS) in young and middle aged patients with phlebothromboses (PT).

Material And Methods: Enzyme immunoassays for lupus anticoagulant, PCR determination of G1691A mutation in the gene of coagulation factor V, mutation G20210A in prothrombin gene, mutation C677T in methylenetetrahydrofolate reductase (MTHFR) gene were made in 97 patients (57 males and 40 females) with venous thrombosis as well as estimation of external and internal coagulation, antithrombin III activity, protein C activity, plasma fibrinogen, stimulated platelet aggregation, blood and plasma viscosity.

Results: APS was detected in 20.

Evaluation of the efficacy of heparins of varying molecular mass and duration of their use in the treatment of patients with acute venous thrombosis.

This paper analyses the results of examination and treatment of 90 patients with acute thrombosis in the inferior vena cava system. To verify the diagnosis, use was made of contrast phlebography (retrograde iliocavography), ultrasound angioscanning, and perfusion scanning of the lungs, The treatment was carried out using heparins of varying molecular mass given for a short and longer time together with indirect anticoagulants. It has been demonstrated that the use of low-molecular heparin does not produce any noticeable changes in the hemostatic system, which can be revealed by standard coagulation tests.

[Diagnostic value of Dopplerography in mechanical intestinal blockage].

With intestinal obstruction taken into consideration, it is thought to be expedient to study changes to hemodynamics occurring in the basin of the superior mesenteric artery (SMA) with the help of dopplerography. A reliable elevation was noted in indices of the peak systolic circulation rate in SMA, mean linear circulation rate in SMA, correlation between the peak systolic rate in SMA and the systolic rate in the abdominal aorta, volume circulation rate in SMA. In addition, these indices were shown to depend on the level of the obstacle resulting in intestinal obstruction.

[Treatment of complications of pylorus preserving stomach resection].

Causes of unsatisfactory outcomes of pylorus preserving stomach resection are analyzed, method of prophylaxis and surgical correction is proposed. Pylorus preserving stomach resection was performed in 207 patients with chronic gastric ulcer. 2 groups of patients were compared: 166 patients who have undergone pylorus preserving stomach resection by Maky--Gorobashko (group 1); 41 patients operated according to an original method of suprapyloric stomach resection with preserving of distal Latarget nerves on serous-muscular flap formed from lesser curvature of the stomach (group 2).

[Photo-hemo-correction in the complex treatment of patients with obliterating atherosclerosis of the arteries of the lower limbs].

Based on the assessment of clinical efficiency of the intravascular and percutaneous photomodification of blood with a helium-neon laser in 170 patients the authors have shown that it is expedient to include the photohemocorrection in the medical programs for the I-III degree ischemia.

[Polymorphism of GPIIIA platelet glycoprotein gene PIA1/A2 compared to plasma hemostasis in myocardial infarction patients].

Aim: To investigate gene PIA1/A2 polymorphism and some parameters of plasma hemostasis in postmyocardial infarction (PMI) patients with chronic cardiac failure (CCF).

Materials And Methods: A total of 58 PMI patients with CCF, pulmonary artery thromboembolism (PATE), phlebothrombosis (PT) were examined. The age of the patients ranged from 24 to 84 years.

New DNA diagnostic system for detection of factor V Leiden.

Use was made of allele-specific PCR to develop a highly effective DNA diagnostic system for detection of the factor V Leiden mutation in exon 10 of human factor V gene. The allele-specific primers contain a 3'-OH end nucleotide, which matches a mutant or wild-type nucleotide of the template DNA (A-allele and G-allele, respectively) and also one mismatched nucleotide near the 3'-end. The universal primers have an internal mismatch with the mutant nucleotide of the template DNA and another mismatched nucleotide at 3'-OH end.

[Pharmacotherapeutical management of bronchial asthma].

The analysis of the prescriptions for bronchial asthma (BA) patients in outpatient practice was made using data base created at the Regional Fund of Obligatory Health Insurance in the Sverdlovsk region with consideration of GINA principles of BA stepped care. The real structure of prescriptions was compared with the pattern drug official list for asthma care. The cost of each BA care step was calculated on the base of the computer programs.

[New allele-specific primers for detection of Leiden mutation in exon 10 of factor V gene in thrombophilias].

New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5')TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994.

[Rehabilitation of patients following the implantation of an anti-embolism cava filter].

The article analyses the efficacy of rehabilitation measures after implantation of a REPTELA cava-filter in 750 patients in the immediate postimplantation period and in 400 patients in late-term periods of up to 8 years. The average duration of the hospital stage of rehabilitation was 45 days for patients with thromboembolism of the pulmonary artery and 22 days for those without this condition. The application of a complex of rehabilitation measures makes it possible to restore the working capacity of 78.

[Analysis of the effectiveness of emergency treatment of cerebral ischemic stroke in first aid conditions].

The impact of the delay in therapeutic intervention at the acute stage of the disease on restitution of neurological functions is shown in 493 patients with ischemic brain stroke, admitted to an emergency neurology unit. The regress of neurological symptoms was notable in 62.9% of patients who were treated by the 6th hour since the disease onset.

[Hemorheological aspects of the Arvin therapy of acute thromboses of the magistral veins of the lower extremities].

The rheologic blood properties were studied in patients with acute venous thrombosis during Arvin therapy. A marked correcting effect of the agent in removing the hemorheological disorders was demonstrated. It was found that the action of Arvin, linked with reduction of fibrinogen concentration, is attended by a decrease of blood viscosity, diminished aggregation of blood formed elements, and improvement of the functional condition of the microcirculatory bed during the whole course of treatment.

[State of the ileocaval segment after implantation of the REPTEL antiembolic cava filter].

The condition of the inferior vena cava system was studied in 597 patients after percutaneous implantation of the antiembolic cava-filter on the basis of the clinical findings and results of angiographic and pathoanatomical examination. The patency of the inferior vena cava was found to be maintained in the immediate postimplantation period in most patients. The causes of occlusion of the inferior vena cava in 10% of cases (according to the clinical findings) were embolic occlusion of the cava-filter and ascending thrombosis of the iliocaval segment.

[Hemorheology and blood thrombotic potential in pulmonary thromboembolism].

Examination of 138 patients with acute venous thrombosis of the lower limbs, which was complicated by thromboembolism of the pulmonary artery in 49 of them, showed the rheologic status to be disturbed to a greater extent in patients with pulmonary embolism than in those with acute venous thrombosis. An interrelationship between the rheologic properties and the coagulation system of the blood in various conditions of the hemostasis system was revealed. It is pointed out that pathogenetically grounded correction of the disorders of the blood coagulation and rheologic systems is necessary in choosing the method for treatment and prevention of acute venous thrombosis and pulmonary embolism.