Transfection efficiency of 25-kDa PEI-cholesterol conjugates with different levels of modification.

This report describes lipophilic conjugates of 25-kDa polyethylenimine (PEI) designed to provide better vectors for nucleic acid transfection. Conjugation of cholesterol is known both to improve transfection properties of PEIs and to reduce their cytotoxic effect. However, extensive modification would significantly decrease the polymer overall positive charge, resulting in less efficient condensation and poor delivery of nucleic acids into cells.

[Chemical ribonucleases: VII. Effect of positively charged RNA-binding domains and hydrophobic fragments of the conjugates based on 1,4-diazabicyclo[2.2.2]octane and imidazol on their ribonuclease activity].

The effect of the total positive charge in the RNA-binding domain of chemical ribonucleases that are conjugates of bisquaternary salts of diazabicyclo[2.2.2]octane and imidazol on the cleavage of an HIV-1 RNA fragment was studied.

[Kinetic parameters of hydrolysis of CpA and UpA sequences in an oligoribonucleotide by compounds functionally mimicking ribonuclease A].

Kinetic parameters of cleavage of CpA and UpA sequences in an oligoribonucleotide under the action of artificial ribonuclease ABL3C1 were measured. The compounds were built of RNA-binding domain B, catalytic fragment C, linker L3 comprising 3 methylene groups, and aliphatic fragment A. The rate of cleavage of phosphodiester bonds in CpA sequence within decaribonucleotide UUCAUGUAAA was shown to be 3.

[Chemical ribonucleases. 4. Analysis of the fragment structure of chemical ribonucleases based on 1,4-diazabicyclo[2.2.2]octane].

Artificial ribonucleases of the ABLkCm series were synthesized. They consist of a lipophilic alkyl radical (Et, n-C14H29, or C15H31) A, an "RNA-binding domain" B (bisquaternary salt of 1,4-diazabicyclo[2.2.

[Chemical ribonucleases. 3. Synthesis of organic catalysts of hydrolysis of phosphodiester bonds based on quaternary salts of 1,4-diazabicyclo(2.2.2)octane].

On the basis of imidazole and bisquaternary salts of 1,4-diazabicyclo[2.2.2]octane, a number of highly effective catalysts of the nDm series (here, n is the number of positive charges at neutral pH values and m is the digital code of the catalytically active fragment: 1, histamine, and 2, histidine methyl ester) were synthesized for the cleavage of the phosphodiester bonds in ribonucleic acids.

[Chemical ribonucleases. 2. Design and hydrolytic properties RNase mimetics based on diazabicyclo[2.2.2]octane with various positive charges].

A procedure was proposed allowing one to synthesize RNA mimics on the basis of conjugates of diazabicyclo[2.2.2]octane with imidazole bearing a varying number of positive charges (nDm series, where n is the number of positive charges at neutral pH, m is the code of an imidazole-containing fragment of the catalytic domain: 1, histamine; 2, histidine methyl ester).

[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides].

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.

[Nuclear peptides, specifically binding oligonucleotides].

Interaction of alkylating derivatives of oligonucleotides with nuclear extracts from mammalian cells has been investigated. Three modified 1.5-, 3.

[Regulation of the expression of the c-fos gene in cells, reverting from being transformed to the pseudonormal phenotype].

Regulation of c-fos expression in mice sarcoma cell lines CBA and C3H was investigated. Each of the cell lines was represented by a pair of clones: the tumorigenic and the one, which was produced from it by cloning. It was found, that c-fos expression in cells of the pseudonormal phenotype was similar to that in the normal fibroblasts.