Upregulation of ISG15 induced by MAPT/tau accumulation represses autophagic flux by inhibiting HDAC6 activity: a vicious cycle in alzheimer disease.

Alzheimer disease (AD), a prevalent neurodegenerative condition in the elderly, is marked by a deficit in macroautophagy/autophagy, leading to intracellular MAPT/tau accumulation. While ISG15 (ISG15 ubiquitin like modifier) has been identified as a regulator of selective autophagy in ataxia telangiectasia (A-T), its role in AD remains unexplored. Our study reveals elevated ISG15 levels in the brains of patients with sporadic AD and AD models and .

Redefining chimeric antigen receptor T-cell (CAR-T) regulation: China's responses to address secondary cancer risks of CAR-T therapy.

Since the United States Food and Drug Administration (FDA) approved the first chimeric antigen receptor T-cell (CAR-T) therapy in 2017, it has marked a major breakthrough in cancer treatment, leading to a surge in global research and applications in this field. In recent years, China has made rapid progress, quickly catching up through heavy investment in CAR-T construction, preparation processes, and treatment strategies. China's CAR-T therapy market is driven by substantial pharmaceutical investment targeting its vast population, yet high therapy costs remain uncovered by basic medical insurance.

Exploring the potential mechanism of Xiaojin Pill therapy for benign prostatic hyperplasia through metabolomics and gut microbiota analysis.

Background: Xiaojin Pill (XJP) is a traditional Chinese medicine prescribed for treating benign prostatic hyperplasia (BPH). It has been proven to have multiple effects, such as regulating sex hormone levels, exhibiting anti-tumor, anti-inflammatory, analgesic, and anti-platelet aggregation properties, and improving immunity. However, the material basis of XJP's therapeutic effect on BPH and its metabolic process remains to be clarified.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly.

Gut microbiota in insulin resistance: a bibliometric analysis.

Background: Insulin resistance (IR) is considered the pathogenic driver of diabetes, and can lead to obesity, hypertension, coronary artery disease, metabolic syndrome, and other metabolic disorders. Accumulating evidence indicates that the connection between gut microbiota and IR. This bibliometric analysis aimed to summarize the knowledge structure of gut microbiota in IR.

The role of tetrahydrocurcumin in disease prevention and treatment.

In recent decades, natural compounds derived from herbal medicine or dietary sources have played important roles in prevention and treatment of various diseases and have attracted more and more attention. Curcumin, extracted from the and widely used as food spice and coloring agent, has been proven to possess high pharmacological value. However, the pharmacological application of curcumin is limited due to its poor systemic bioavailability.

[Bioinformatics database and production layout visual analysis platform of medicinal plants:a case study of Dao-di medicinal materials in Sichuan province].

In the new stage of trans-omics and trans-subjects for medicinal plants, it is an urgent need to integrate big data, provide interactive applications, and form a unified and multi-level research system and big data platform. Dao-di medicinal material, as an important source of medicinal plants, is a unique quality concept and comprehensive standard of tranditional Chinese medicine(TCM). Several databases have been developed in China and abroad, such as the Encyclopedia of Traditional Chinese Medicine(ETCM) and the Global Pharmacopoeia Genome Database(GPGD).

[Betulinic acid inhibits non-small cell lung cancer by repolarizing tumor-associated macrophages via mTOR signaling pathway].

The abnormal activation of the mammalian target of rapamycin(mTOR) signaling pathway in non-small cell lung cancer(NSCLC) is closely associated with distant metastasis, drug resistance, tumor immune escape, and low overall survival. The present study reported that betulinic acid(BA), a potent inhibitor of mTOR signaling pathway, exhibited an inhibitory activity against NSCLC in vitro and in vivo. CCK-8 and colony formation results demonstrated that BA significantly inhibited the viability and clonogenic ability of H1299, A549, and LLC cells.

[New drug discovery and prospect of small nucleic acids derived from traditional Chinese medicine and natural medicine].

Small nucleic acid drugs mainly include small interfering RNA(siRNA), antisense oligonucleotide(ASO), microRNA(miRNA), messenger RNA(mRNA), nucleic acid aptamer(aptamer), and so on. Its translation or regulation can be inhibited by binding to the RNA of the target molecule. Due to its strong specificity, persistence, and curability, small nucleic acid drugs have received considerable attention in recent years.

Determination of the chromosomal position effects for plug-and-play application in the chassis cells.

The chromosomal position effect can significantly affect the transgene expression, which may provide an efficient strategy for the inauguration of alien genes in new hosts, but has been less explored rationally. The bacterium harbors a large circular high-GC genome, and the position effect in this chassis may result in a thousand-fold expression variation of alien natural products. In this study, we conducted transposon insertion at TA sites on the genome, and used enrichment and dilution indexes to respectively appraise high and low expression potentials of alien genes at insertion sites.

A positive feedback inhibition of isocitrate dehydrogenase 3β on paired-box gene 6 promotes Alzheimer-like pathology.

Impaired brain glucose metabolism is an early indicator of Alzheimer's disease (AD); however, the fundamental mechanism is unknown. In this study, we found a substantial decline in isocitrate dehydrogenase 3β (IDH3β) levels, a critical tricarboxylic acid cycle enzyme, in AD patients and AD-transgenic mice's brains. Further investigations demonstrated that the knockdown of IDH3β induced oxidation-phosphorylation uncoupling, leading to reduced energy metabolism and lactate accumulation.

BGP-15 alleviates LPS-induced depression-like behavior by promoting mitophagy.

The high prevalence of major depressive disorder (MDD) frequently imposes severe constraints on psychosocial functioning and detrimentally impacts overall well-being. Despite the growing interest in the hypothesis of mitochondrial dysfunction, the precise mechanistic underpinnings and therapeutic strategies remain unclear and require further investigation. In this study, an MDD model was established in mice using lipopolysaccharide (LPS).

Glucuronidation dynamics of curcumin and tetrahydrocurcumin for differential structures and chemical reactivities in human liver microsome and uridine diphosphate glucuronosyltransferase 2B7.

THC is the main metabolite of curcumin with better bioactivity. This study aimed to explore the factors that cause differences in the bioactivity of curcumin and THC. We analyzed the metabolic activities of curcumin and THC and the factors responsible for the differences in their activities by glucuronidation activity assay, LC-MS, HPLC, homologous sequence comparisons, and molecular docking.

Acetylated tau exacerbates apoptosis by disturbing mitochondrial dynamics in HEK293 cells.

An increase in tau acetylation at K274 and K281 and abnormal mitochondrial dynamics have been observed in the brains of Alzheimer's disease (AD) patients. Here, we constructed three types of tau plasmids, TauKQ (acetylated tau mutant, by mutating its K274/K281 into glutamine to mimic disease-associated lysine acetylation), TauKR (non-acetylated tau mutant, by mutating its K274/K281 into arginine), and TauWT (wild-type human full-length tau). By transfecting these tau plasmids in HEK293 cells, we found that TauWT and TauKR induced mitochondrial fusion by increasing the level of mitochondrial fusion proteins.

Identification of γ-Fagarine as a novel antiviral agent against respiratory virus (hMPV) infection.

Human metapneumovirus (hMPV) causes significant upper and lower respiratory disease in all age groups worldwide. However, there is no licensed drugs or vaccine available against hMPV. γ-Fagarine, an alkaloid isolated from the root of zanthoxylum, has been reported to be effective in the treatment of cancer, inflammatory diseases and antivirals.

Cholinergic signaling of muscarinic receptors directly involves in the neuroprotection of muscone by inducing Ca antagonism and maintaining mitochondrial function.

Ethnopharmacological Relevance: Musk, a traditional Chinese medicine, is broadly used in inducing resuscitation and refreshing the mind, activating blood and alleviating pain. It is commonly used for the treatment of ischemic stroke, and muscone is its core medicinal component.

Aim Of The Study: The aim of this study was to explore whether muscone ameliorates neuronal damage through cholinergic signaling of muscarinic receptors.

Sources, morphology, phytochemistry, pharmacology of , , and : a review of the literature.

(turmeric), and are derived from the species, and have gradually become three of the most commonly used medicinal herbs in China due to their different origins, processing methods and medicinal part. These three herbs have certain similarities in morphology, chemical composition, and pharmacological effects. All three of these herbs contain curcuminoids and volatile oil compounds, which exhibit anti-inflammatory, anti-tumor, antioxidant, and neuroprotective properties, although modern clinical applications have their own requirements.

The role of the symbiotic microecosystem in cancer: gut microbiota, metabolome, and host immunome.

The gut microbiota is not just a simple nutritional symbiosis that parasitizes the host; it is a complex and dynamic ecosystem that coevolves actively with the host and is involved in a variety of biological activities such as circadian rhythm regulation, energy metabolism, and immune response. The development of the immune system and immunological functions are significantly influenced by the interaction between the host and the microbiota. The interactions between gut microbiota and cancer are of a complex nature.

Kinsenoside from Anoectochilus roxburghii (Wall.) Lindl. suppressed oxidative stress to attenuate aging-related learning and memory impairment via ERK/Nrf2 pathway.

Ethnopharmacological Relevance: Anoectochilusroxburghii (Wall.) Lindl. (AR), as an exceptionally valuable traditional Chinese medicine, has been widely used to treat hepatitis, cancer, diabetes, etc.

LC-MS-based metabolomics reveals the mechanism of anti-gouty arthritis effect of Wuwei Shexiang pill.

Wuwei Shexiang Pill (WSP) is a Tibetan traditional medicine, which has been demonstrated to exhibit potent anti-inflammatory and anti-gout effects. However, the specific pharmacological mechanism is not elucidated clearly. In the present study, liquid chromatography-mass spectrometry (LC-MS)-based metabolomics was applied to investigate the alteration of serum metabolites induced by WSP treatment in MSU-induced gouty rats.

Polypeptide from Moschus Suppresses Lipopolysaccharide-Induced Inflammation by Inhibiting NF-κ B-ROS/NLRP3 Pathway.

Objective: To examine the anti-inflammatory effects and potential mechanisms of polypeptide from Moschus (PPM) in lipopolysaccharide (LPS)-induced THP-1 macrophages and BALB/c mice.

Methods: The polypeptide was extracted from Moschus and analyzed by high-performance liquid chromatography and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Subsequently, LPS was used to induce inflammation in THP-1 macrophages and BALB/c mice.

A systematic review of the research progress of traditional Chinese medicine against pulmonary fibrosis: from a pharmacological perspective.

Pulmonary fibrosis is a chronic progressive interstitial lung disease caused by a variety of etiologies. The disease can eventually lead to irreversible damage to the lung tissue structure, severely affecting respiratory function and posing a serious threat to human health. Currently, glucocorticoids and immunosuppressants are the main drugs used in the clinical treatment of pulmonary fibrosis, but their efficacy is limited and they can cause serious adverse effects.