Release of DNA oligonucleotides and their conjugates from controlled-pore glass under thermolytic conditions.

The sequential functionalization of long-chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and a dinucleoside phosphorotetrazolide leads to a uniquely engineered support for solid-phase synthesis. Unlike conventional succinylated-CPG supports, this support is designed to allow oligonucleotide deprotection and elimination of deprotection side-products to proceed without release of the oligonucleotide. When needed, the DNA oligonucleotide can be thermolytically released in 2 hr under essentially neutral conditions.

Thermolytic release of covalently linked DNA oligonucleotides and their conjugates from controlled-pore glass at near neutral pH.

The functionalization of long chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and its conversion to the support 7 has led to the synthesis of DNA oligonucleotides and their 3'- or (3',5')-conjugates. Indeed, CPG support 7 has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. Unlike conventional succinylated CPG supports, this distinctively functionalized support allows oligonucleotide deprotection and removal of the deprotection side products to proceed without releasing the oligonucleotide into the aqueous milieu.

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides.

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.

Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis.

The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.

Solid-phase synthesis of thermolytic DNA oligonucleotides functionalized with a single 4-hydroxy-1-butyl or 4-phosphato-/thiophosphato-1-butyl thiophosphate protecting group.

Several thermolytic CpG-containing DNA oligonucleotides analogous to 1 have been synthesized to serve as potential immunotherapeutic oligonucleotide prodrug formulations for the treatment of infectious diseases in animal models. Specifically, the CpG motif (GACGTT) of each DNA oligonucleotide has been functionalized with either the thermolabile 4-hydroxy-1-butyl or the 4-phosphato-/thiophosphato-1-butyl thiophosphate protecting group. This functionalization was achieved through incorporation of activated deoxyribonucleoside phosphoramidite 8b into the oligonucleotide chain during solid-phase synthesis and, optionally, through subsequent phosphorylation effected by phosphoramidite 9.

31P NMR study of the desulfurization of oligonucleoside phosphorothioates effected by "aged" trichloroacetic acid solutions.

When employing phosphoramidites 1a-d in the solid-phase synthesis of oligonucleoside phosphorothioates, the thermolytic 2-[N-methyl-N-(2-pyridyl)]aminoethyl thiophosphate protecting group is lost to a large extent during the course of the synthesis. The resulting phosphorothioate diesters are then substantially desulfurized upon recurring exposure to a commercial solution of deblocking reagent during chain assembly. This problem is caused by the secondary decomposition product(s) of the reagent and is alleviated by using a fresh solution of the deblocking reagent prepared from solid trichloroacetic acid.