Structural and functional effects of phosphopriming and scaffolding in the kinase GSK-3β.

Glycogen synthase kinase 3β (GSK-3β) targets specific signaling pathways in response to distinct upstream signals. We used structural and functional studies to dissect how an upstream phosphorylation step primes the Wnt signaling component β-catenin for phosphorylation by GSK-3β and how scaffolding interactions contribute to this reaction. Our crystal structure of GSK-3β bound to a phosphoprimed β-catenin peptide confirmed the expected binding mode of the phosphoprimed residue adjacent to the catalytic site.

Systems-Level Modeling for CRISPR-Based Metabolic Engineering.

The CRISPR-Cas system has enabled the development of sophisticated, multigene metabolic engineering programs through the use of guide RNA-directed activation or repression of target genes. To optimize biosynthetic pathways in microbial systems, we need improved models to inform design and implementation of transcriptional programs. Recent progress has resulted in new modeling approaches for identifying gene targets and predicting the efficacy of guide RNA targeting.

Computational stabilization of a non-heme iron enzyme enables efficient evolution of new function.

Directed evolution has emerged as a powerful tool for engineering new biocatalysts. However, introducing new catalytic residues can be destabilizing, and it is generally beneficial to start with a stable enzyme parent. Here we show that the deep learning-based tool ProteinMPNN can be used to redesign Fe(II)/αKG superfamily enzymes for greater stability, solubility, and expression while retaining both native activity and industrially-relevant non-native functions.

Guide RNA structure design enables combinatorial CRISPRa programs for biosynthetic profiling.

Engineering metabolism to efficiently produce chemicals from multi-step pathways requires optimizing multi-gene expression programs to achieve enzyme balance. CRISPR-Cas transcriptional control systems are emerging as important tools for programming multi-gene expression, but poor predictability of guide RNA folding can disrupt expression control. Here, we correlate efficacy of modified guide RNAs (scRNAs) for CRISPR activation (CRISPRa) in E.

CRISPR-Cas tools for simultaneous transcription & translation control in bacteria.

Robust control over gene translation at arbitrary mRNA targets is an outstanding challenge in microbial synthetic biology. The development of tools that can regulate translation will greatly expand our ability to precisely control genes across the genome. In Escherichia coli, most genes are contained in multi-gene operons, which are subject to polar effects where targeting one gene for repression leads to silencing of other genes in the same operon.

Engineering bacteria for cancer immunotherapy.

Bacterial therapeutics have emerged as promising delivery systems to target tumors. These engineered live therapeutics can be harnessed to modulate the tumor microenvironment or to deliver and selectively release therapeutic payloads to tumors. A major challenge is to deliver bacteria systemically without causing widespread inflammation, which is critical for the many tumors that are not accessible to direct intratumoral injection.

The Axin scaffold protects the kinase GSK3β from cross-pathway inhibition.

Multiple signaling pathways regulate the kinase GSK3β by inhibitory phosphorylation at Ser9, which then occupies the GSK3β priming pocket and blocks substrate binding. Since this mechanism should affect GSK3β activity toward all primed substrates, it is unclear why Ser9 phosphorylation does not affect other GSK3β-dependent pathways, such as Wnt signaling. We used biochemical reconstitution and cell culture assays to evaluate how Wnt-associated GSK3β is insulated from cross-activation by other signals.

Engineering activatable promoters for scalable and multi-input CRISPRa/i circuits.

Dynamic, multi-input gene regulatory networks (GRNs) are ubiquitous in nature. Multilayer CRISPR-based genetic circuits hold great promise for building GRNs akin to those found in naturally occurring biological systems. We develop an approach for creating high-performing activatable promoters that can be assembled into deep, wide, and multi-input CRISPR-activation and -interference (CRISPRa/i) GRNs.

Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants.

CRISPR-Cas transcriptional tools have been widely applied for programmable regulation of complex biological networks. In comparison to eukaryotic systems, bacterial CRISPR activation (CRISPRa) has stringent target site requirements for effective gene activation. While genes may not always have an NGG protospacer adjacent motif (PAM) at the appropriate position, PAM-flexible dCas9 variants can expand the range of targetable sites.

A kinetic mechanism for systems-level behavior in GTPase signaling.

GTPase switches are hubs for multiple distinct cell signaling inputs and outputs. In a new study combining genetic and biochemical methods, Perica, Mathy et al. identify an unexpected connection between the kinetics of a GTPase switch cycle and functional specificity.

Multi-layer CRISPRa/i circuits for dynamic genetic programs in cell-free and bacterial systems.

CRISPR-Cas transcriptional circuits hold great promise as platforms for engineering metabolic networks and information processing circuits. Historically, prokaryotic CRISPR control systems have been limited to CRISPRi. Creating approaches to integrate CRISPRa for transcriptional activation with existing CRISPRi-based systems would greatly expand CRISPR circuit design space.

CRISPR-Cas-Mediated Tethering Recruits the Yeast Mating-Type Locus to the Nuclear Periphery but Fails to Silence Gene Expression.

To investigate the relationship between genome structure and function, we have developed a programmable CRISPR-Cas system for nuclear peripheral recruitment in yeast. We benchmarked this system at the and loci, both of which are well-characterized model systems for localization to the nuclear periphery. Using microscopy and gene silencing assays, we demonstrate that CRISPR-Cas-mediated tethering can recruit the locus but does not detectably silence reporter gene expression.

Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida.

CRISPR-Cas transcriptional programming in bacteria is an emerging tool to regulate gene expression for metabolic pathway engineering. Here we implement CRISPR-Cas transcriptional activation (CRISPRa) in P. putida using a system previously developed in E.

Conditional Recruitment to a DNA-Bound CRISPR-Cas Complex Using a Colocalization-Dependent Protein Switch.

To spatially control biochemical functions at specific sites within a genome, we have engineered a synthetic switch that activates when bound to its DNA target site. The system uses two CRISPR-Cas complexes to colocalize components of a -designed protein switch (Co-LOCKR) to adjacent sites in the genome. Colocalization triggers a conformational change in the switch from an inactive closed state to an active open state with an exposed functional peptide.

Challenges and opportunities with CRISPR activation in bacteria for data-driven metabolic engineering.

Creating CRISPR gene activation (CRISPRa) technologies in industrially promising bacteria could be transformative for accelerating data-driven metabolic engineering and strain design. CRISPRa has been widely used in eukaryotes, but applications in bacterial systems have remained limited. Recent work shows that multiple features of bacterial promoters impose stringent requirements on CRISPRa-mediated gene activation.

The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions.

Scaffold proteins are thought to promote signaling specificity by accelerating reactions between bound kinase and substrate proteins. To test the long-standing hypothesis that the scaffold protein Axin accelerates glycogen synthase kinase 3β (GSK3β)-mediated phosphorylation of β-catenin in the Wnt signaling network, we measured GSK3β reaction rates with multiple substrates in a minimal, biochemically reconstituted system. We observed an unexpectedly small, ∼2-fold Axin-mediated rate increase for the β-catenin reaction when measured in isolation.

The Relationship between Effective Molarity and Affinity Governs Rate Enhancements in Tethered Kinase-Substrate Reactions.

Scaffold proteins are thought to accelerate protein phosphorylation reactions by tethering kinases and substrates together, but there is little quantitative data on their functional effects. To assess the contribution of tethering to kinase reactivity, we compared intramolecular and intermolecular kinase reactions in a minimal model system. We found that tethering can enhance reaction rates in a flexible tethered kinase system and that the magnitude of the effect is sensitive to the structure of the tether.

Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements.

In bacterial systems, CRISPR-Cas transcriptional activation (CRISPRa) has the potential to dramatically expand our ability to regulate gene expression, but we lack predictive rules for designing effective gRNA target sites. Here, we identify multiple features of bacterial promoters that impose stringent requirements on CRISPRa target sites. Notably, we observe narrow, 2-4 base windows of effective sites with a periodicity corresponding to one helical turn of DNA, spanning ~40 bases and centered ~80 bases upstream of the TSS.

CRISPR-Cas-Mediated Chemical Control of Transcriptional Dynamics in Yeast.

Synthetic CRISPR-Cas transcription factors enable the construction of complex gene-expression programs, and chemically inducible systems allow precise control over the expression dynamics. To provide additional modes of regulatory control, we have constructed a chemically inducible CRISPR activation (CRISPRa) system in yeast that is mediated by recruitment to MS2-functionalized guide RNAs. We use reporter gene assays to systematically map the dose dependence, time dependence, and reversibility of the system.

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Methods to regulate gene expression programs in bacterial cells are limited by the absence of effective gene activators. To address this challenge, we have developed synthetic bacterial transcriptional activators in E. coli by linking activation domains to programmable CRISPR-Cas DNA binding domains.

Prospects for engineering dynamic CRISPR-Cas transcriptional circuits to improve bioproduction.

Dynamic control of gene expression is emerging as an important strategy for controlling flux in metabolic pathways and improving bioproduction of valuable compounds. Integrating dynamic genetic control tools with CRISPR-Cas transcriptional regulation could significantly improve our ability to fine-tune the expression of multiple endogenous and heterologous genes according to the state of the cell. In this mini-review, we combine an analysis of recent literature with examples from our own work to discuss the prospects and challenges of developing dynamically regulated CRISPR-Cas transcriptional control systems for applications in synthetic biology and metabolic engineering.

Regulated Expression of sgRNAs Tunes CRISPRi in E. coli.

Methods for implementing dynamically-controlled multi-gene programs could expand capabilities to engineer metabolism for efficiently producing high-value compounds. This work explores whether CRISPRi repression can be tuned in E. coli through the regulated expression of the CRISPRi machinery.

Additive Manufacturing of Catalytically Active Living Materials.

Living materials, which are composites of living cells residing in a polymeric matrix, are designed to utilize the innate functionalities of the cells to address a broad range of applications such as fermentation and biosensing. Herein, we demonstrate the additive manufacturing of catalytically active living materials (AMCALM) for continuous fermentation. A multi-stimuli-responsive yeast-laden hydrogel ink, based on F127-dimethacrylate, was developed and printed using a direct-write 3D printer.