Hot spot profiles of SARS-CoV-2 and human ACE2 receptor protein protein interaction obtained by density functional tight binding fragment molecular orbital method.

The prevalence of a novel β-coronavirus (SARS-CoV-2) was declared as a public health emergency of international concern on 30 January 2020 and a global pandemic on 11 March 2020 by WHO. The spike glycoprotein of SARS-CoV-2 is regarded as a key target for the development of vaccines and therapeutic antibodies. In order to develop anti-viral therapeutics for SARS-CoV-2, it is crucial to find amino acid pairs that strongly attract each other at the interface of the spike glycoprotein and the human angiotensin-converting enzyme 2 (hACE2) complex.

PMFF: Development of a Physics-Based Molecular Force Field for Protein Simulation and Ligand Docking.

The physics-based molecular force field (PMFF) was developed by integrating a set of potential energy functions in which each term in an intermolecular potential energy function is derived based on experimental values, such as the dipole moments, lattice energy, proton transfer energy, and X-ray crystal structures. The term "physics-based" is used to emphasize the idea that the experimental observables that are considered to be the most relevant to each term are used for the parameterization rather than parameterizing all observables together against the target value. PMFF uses MM3 intramolecular potential energy terms to describe intramolecular interactions and includes an implicit solvation model specifically developed for the PMFF.

Investigation of protein-protein interactions and hot spot region between PD-1 and PD-L1 by fragment molecular orbital method.

Inhibitors to interfere protein-protein interactions (PPI) between programmed cell death 1 (PD-1) and programmed death ligand-1 (PD-L1) block evasion of cancers from immune surveillance. Analyzing hot spot residues in PPI is important for small-molecule drug development. In order to find out hot spots on PPI interface in PD-1/PD-L1 complex, we analyzed PPI in PD-1/PD-L1 with a new analysis method, 3-dimensional scattered pair interactions energies (3D-SPIEs), which assorts significant interactions with fragment molecular orbital (FMO) method.

Terpestacin inhibits tumor angiogenesis by targeting UQCRB of mitochondrial complex III and suppressing hypoxia-induced reactive oxygen species production and cellular oxygen sensing.

Cellular oxygen sensing is required for hypoxia-inducible factor-1alpha stabilization, which is important for tumor cell survival, proliferation, and angiogenesis. Here we find that terpestacin, a small molecule previously identified in a screen of microbial extracts, binds to the 13.4-kDa subunit (UQCRB) of mitochondrial Complex III, resulting in inhibition of hypoxia-induced reactive oxygen species generation.

Identification and validation of calmodulin as a binding protein of an anti-proliferative small molecule 3,4-dihydroisoquinolinium salt.

IHY-153 (2-(2,5-difluorobenzyl)-3,4-dihydro-5-(10-hydroxydecyl)-6-methoxy-1-undecylisoquinolinium bromide) was recently discovered as a small molecule that potently inhibits proliferation of tumor cells by inducing cell-cycle arrest at G0-G1 phase. To investigate the basis of anti-proliferative activity of IHY-153, cellular binding proteins of biotinyl-IHY-153 were screened using T7 phage displayed human cDNA libraries. Calmodulin-expressing phage specifically bound to immobilized IHY-153 in a Ca(2+) -dependent manner.

Identification of novel inhibitors of HCV RNA-dependent RNA polymerase by pharmacophore-based virtual screening and in vitro evaluation.

Hepatitis C virus (HCV) is the major etiological agent of non-A, non-B hepatitis where no effective treatment is available. The HCV NS5B with RNA-dependent RNA polymerase (RdRp) activity is a key target for the treatment of HCV infection. Here we report novel NS5B polymerase inhibitors identified by virtual screening and in vitro evaluation of their inhibitory activities.

Structural modeling of V299L and E459K Bcr-Abl mutation, and sequential therapy of tyrosine kinase inhibitors for the compound mutations.

Sequential treatment with different tyrosine kinase inhibitors (TKIs) is one of the strategies for handling chronic myeloid leukemia (CML) in which dynamic change in Bcr-Abl kinase domain mutation is often an obstacle faced during TKI therapy. Here we report successful sequential therapy with different TKIs for the CML patient harboring V299L and E459K compound mutations. Molecular monitoring including quantitative analysis of BCR-ABL transcript level and mutation analysis were performed regularly for successful treatment.

Quinazolines as potent and highly selective PDE5 inhibitors as potential therapeutics for male erectile dysfunction.

In an effort to minimize side effects associated with low selectivity against PDE isozymes, we have successfully identified a series of 6,7,8-substituted quinzaolines as potent inhibitors of PDE5 with high level of isozyme selectivity, especially against PDE6 and PDE11. PDE5 potency and isozyme selectivity of quinazolines were greatly improved with substitutions both at 6- and 8-position. The synthesis, structure-activity relationships and in vivo efficacy of this novel series of potent PDE5 inhibitors are described.

IDMap: facilitating the detection of potential leads with therapeutic targets.

Unlabelled: Pharmaceutical industry has been striving to reduce the costs of drug development and increase productivity. Among the many different attempts, drug repositioning (retargeting existing drugs) comes into the spotlight because of its financial efficiency. We introduce IDMap which predicts novel relationships between targets and chemicals and thus is capable of repositioning the marketed drugs by using text mining and chemical structure information.

Design and biological evaluation of novel tubulin inhibitors as antimitotic agents using a pharmacophore binding model with tubulin.

Although the structure has been elucidated for the binding of colchicine and podophyllotoxin as potent destabilizer for microtubule formation, very little is known about MDL-27048, a competitive inhibitor for colchicine and podophyllotoxin. The structural basis for the interaction of antimitotic agents with tubulin was investigated by molecular modeling, and we propose binding models for MDL-27048 against tubulin. The proposed model was not only consistent with previous competition experiment data between colchicine and MDL-27048, but further suggested an additional binding cavity on tubulin.

Structure-based virtual screening and biological evaluation of potent and selective ADAM12 inhibitors.

We describe a series of potent and selective inhibitors of ADAM12 that were discovered using computational screening of a focused virtual library. The initial structure-based virtual screening selected 64 compounds from a 3D database of 67,062 molecules. Being evaluated by a cell-based ADAM12 activity assay, compounds 5, 11, 14, 16 were further identified as the potent and selective inhibitors of ADAM12 with low nanomolar IC50 values.

Novel inhibitors targeted to methionine aminopeptidase 2 (MetAP2) strongly inhibit the growth of cancers in xenografted nude model.

Inhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In our study reported here, the effects of 4 highly potent methionine aminopeptidase 2 (MetAP2) inhibitors, IDR-803, IDR-804, IDR-805 and CKD-732 (designed by structure-based molecular modeling), on angiogenesis and tumor growth were assessed. Concentrations of these inhibitors as low as 2.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T).

A dipalmitoyl peptide that binds SH3 domain, disturbs intracellular signal transduction, and inhibits tumor growth in vivo.

The Src homology 3 (SH3) domain plays a crucial role in protein-protein interactions during intracellular signal transduction. Blocking the SH3-mediated protein binding may inhibit the corresponding signal transduction, and thus, block the cellular functions. In this study, a peptide that specifically binds to SH3 domain could be introduced into the intracellular region when the peptides were conjugated with dipalmitic acid and appeared to disturb intracellular signaling.