Limited microbiome differences in captive and semi-wild primate populations consuming similar diets.

Gut microbial communities are shaped by a myriad of extrinsic factors, including diet and the environment. Although distinct human populations consistently exhibit different gut microbiome compositions, variation in diet and environmental factors are almost always coupled, making it difficult to disentangle their relative contributions to shaping the gut microbiota. Data from discrete animal populations with similar diets can help reduce confounds.

Comparative Analysis of Gene Expression Patterns for Oral Epithelial Cell Functions in Periodontitis.

The structure and function of epithelial cells are critical for the construction and maintenance of intact epithelial surfaces throughout the body. Beyond the mechanical barrier functions, epithelial cells have been identified as active participants in providing warning signals to the host immune and inflammatory cells and in communicating various detailed information on the noxious challenge to help drive specificity in the characteristics of the host response related to health or pathologic inflammation. Rhesus monkeys were used in these studies to evaluate the gingival transcriptome for naturally occurring disease samples (GeneChip® Rhesus Macaque Genome Array) or for ligature-induced disease (GeneChip® Rhesus Gene 1.

Oral Microbiome and Gingival Tissue Apoptosis and Autophagy Transcriptomics.

This study focused on documenting characteristics of the gingival transcriptome during various stages of periodontitis targeting genes associated with apoptotic and autophagic pathways and changes that specifically associate with features of the oral microbiome. ( = 18; 12-23 years) were examined at baseline and 0.5, 1, and 3 months of disease progression, as well as 5 months with clinical disease resolution.

Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

Objective: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease.

Background: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection.

Methods: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis.

Microbiome Profiles of Ligature-Induced Periodontitis in Nonhuman Primates across the Life Span.

This investigation compared the microbiomes colonizing teeth during the initiation, progression, and resolution of periodontitis in nonhuman primates () at different ages. Subgingival plaque samples were collected at baseline; 0.5, 1, and 3 months following ligature-induced periodontitis; and following naturally occurring disease resolution at 5 months.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Periodontal disease susceptible matrilines in the Cayo Santiago Macaca mulatta macaques.

Objective And Background: The expression of periodontitis, including age of onset, extent, and severity is considered to represent an interaction of the individual's oral microbiome and host response to the microbial challenge that is modified by both genetics and environmental factors. The aim of this study was to determine the distribution of periodontitis in a population of nonhuman primates, to document features of familial distribution that could reflect heritability and transmission of microbes with enhanced virulence.

Material And Methods: This report presents our findings from evaluation of periodontal disease bone defects in skulls from 569 animals (5-31 years of age) derived from the skeletons of the rhesus monkeys (Macaca mulatta) of Cayo Santiago derived from eight matrilines over 6-9 generations.

Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates.

Background: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and 16 NP receptors (NPRs) coincident with the initiation, progression, and resolution of periodontitis were determined.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear.

Transcriptome Analysis of B Cell Immune Functions in Periodontitis: Mucosal Tissue Responses to the Oral Microbiome in Aging.

Evidence has shown activation of T and B cells in gingival tissues in experimental models and in humans diagnosed with periodontitis. The results of this adaptive immune response are noted both locally and systemically with antigenic specificity for an array of oral bacteria, including periodontopathic species, e.g.

Bone biology-related gingival transcriptome in ageing and periodontitis in non-human primates.

Aim: Cellular and molecular immunoinflammatory changes in gingival tissues drive alveolar bone loss in periodontitis. Since ageing is a risk factor for periodontitis, we sought to identify age-related gingival transcriptome changes associated with bone metabolism in both healthy and in naturally occurring periodontitis.

Materials And Methods: Adult (12-16 years) and aged (18-23 years) non-human primates (M.

The ticking clock of Cayo Santiago macaques and its implications for understanding human circadian rhythm disorders.

The circadian clock disorders in humans remain poorly understood. However, their impact on the development and progression of major human conditions, from cancer to insomnia, metabolic or mental illness becomes increasingly apparent. Addressing human circadian disorders in animal models is, in part, complicated by inverse temporal relationship between the core clock and specific physiological or behavioral processes in diurnal and nocturnal animals.

Familial periodontal disease in the Cayo Santiago rhesus macaques.

Substantial ongoing research continues to explore the contribution of genetics and environment to the onset, extent and severity of periodontal disease(s). Existing evidence supports that periodontal disease appears to have an increased prevalence in family units with a member having aggressive periodontitis. We have been using the nonhuman primate as a model of periodontal disease for over 25 years with these species demonstrating naturally occurring periodontal disease that increases with age.

Cytokine gene expression profiles during initiation, progression and resolution of periodontitis.

Aim: Variations in the expression of cytokines during the progression of periodontitis remain ill-defined. We evaluated the expression of 19 cytokine genes related to T-cell phenotype/function during initiation, progression and resolution of periodontitis, and related these to the expression of soft and bone tissue destruction genes (TDGs).

Materials And Methods: A ligature-induced periodontitis model was used in rhesus monkeys (M.

Personality Traits in Rhesus Macaques () Are Heritable but Do Not Predict Reproductive Output.

There is growing evidence that behavioral tendencies, or "personalities," in animals are an important aspect of their biology, yet their evolutionary basis is poorly understood. Specifically, how individual variation in personality arises and is subsequently maintained by selection remains unclear. To address this gap, studies of personality require explicit incorporation of genetic information.

Comparative analysis of gingival tissue antigen presentation pathways in ageing and periodontitis.

Aim: Gingival tissues of periodontitis lesions contribute to local elevations in mediators, including both specific T cell and antibody immune responses to oral bacterial antigens. Thus, antigen processing and presentation activities must exist in these tissues to link antigen-presenting cells with adaptive immunity. We hypothesized that alterations in the transcriptome of antigen processing and presentation genes occur in ageing gingival tissues and that periodontitis enhances these differences reflecting tissues less capable of immune resistance to oral pathogens.

Response of Rhesus Macaques () to the Body of a Group Member That Died from a Fatal Attack.

Among animals that form social bonds, the death of a conspecific may be a significant social event, representing the loss of an ally and resulting in disruptions to the dominance hierarchy. Despite this potential biological importance, we have only limited knowledge of animals' reactions to the death of a group member. This is particularly true of responses to dead adults, as most reports describe the responses of mothers to dead infants.

Effects of aging on apoptosis gene expression in oral mucosal tissues.

Apoptotic processes are important for physiologic renewal of an intact epithelial barrier and contribute some antimicrobial resistance for bacteria and viruses, as well as anti-inflammatory effects that benefits the mucosa. The oral cavity presents a model of host-bacterial interactions at mucosal surfaces, in which a panoply of microorganisms colonizes various niches in the oral cavity and creates complex multispecies biofilms that challenge the gingival tissues. This report details gene expression in apoptotic pathways that occur in oral mucosal tissues across the lifespan, using a nonhuman primate model.

Genetic origins of social networks in rhesus macaques.

Sociality is believed to have evolved as a strategy for animals to cope with their environments. Yet the genetic basis of sociality remains unclear. Here we provide evidence that social network tendencies are heritable in a gregarious primate.

Serologic host response to Helicobacter pylori and Campylobacter jejuni in socially housed Rhesus macaques (Macaca mulatta).

Background: Helicobacter pylori are successful colonizers of the human gastric mucosa. Colonization increases the risk of peptic ulcer disease and adenocarcinoma. However, potential benefits of H.

Familial circadian rhythm disorder in the diurnal primate, Macaca mulatta.

In view of the inverse temporal relationship of central clock activity to physiological or behavioral outputs in diurnal and nocturnal species, understanding the mechanisms and physiological consequences of circadian disorders in humans would benefit from studies in a diurnal animal model, phylogenetically close to humans. Here we report the discovery of the first intrinsic circadian disorder in a family of diurnal non-human primates, the rhesus monkey. The disorder is characterized by a combination of delayed sleep phase, relative to light-dark cycle, mutual desynchrony of intrinsic rhythms of activity, food intake and cognitive performance, enhanced nighttime feeding or, in the extreme case, intrinsic asynchrony.

Long-distance transportation of primate embryos developing in culture: a preliminary study.

Non-human primate embryos are invaluable for conducting research relevant to human infertility and stem cells, but their availability is restricted. In this preliminary study, rhesus monkey embryos were produced by IVF at the Caribbean Primate Research Centre and shipped in tubes of gassed culture medium within a battery-powered transport incubator by overnight courier to Wayne State University in Michigan. Upon arrival, the embryos were incubated in fresh culture medium to evaluate further development.

Fatal granulomatous meningoencephalitis associated to mycobacterium mucogenicum-like microorganism: a case report.

Mycobacterium mucogenicum is rarely associated to human infections. However, in the last year, a few reports of sepsis and fatal cases of central nervous systems have been documented. Here we report a fatal case of granulomatous meningoencephalitis of three weeks of evolution where DNA from a M.