Systems-Level Modeling for CRISPR-Based Metabolic Engineering.

The CRISPR-Cas system has enabled the development of sophisticated, multigene metabolic engineering programs through the use of guide RNA-directed activation or repression of target genes. To optimize biosynthetic pathways in microbial systems, we need improved models to inform design and implementation of transcriptional programs. Recent progress has resulted in new modeling approaches for identifying gene targets and predicting the efficacy of guide RNA targeting.

Guide RNA structure design enables combinatorial CRISPRa programs for biosynthetic profiling.

Engineering metabolism to efficiently produce chemicals from multi-step pathways requires optimizing multi-gene expression programs to achieve enzyme balance. CRISPR-Cas transcriptional control systems are emerging as important tools for programming multi-gene expression, but poor predictability of guide RNA folding can disrupt expression control. Here, we correlate efficacy of modified guide RNAs (scRNAs) for CRISPR activation (CRISPRa) in E.

CRISPR-Cas tools for simultaneous transcription & translation control in bacteria.

Robust control over gene translation at arbitrary mRNA targets is an outstanding challenge in microbial synthetic biology. The development of tools that can regulate translation will greatly expand our ability to precisely control genes across the genome. In Escherichia coli, most genes are contained in multi-gene operons, which are subject to polar effects where targeting one gene for repression leads to silencing of other genes in the same operon.

CRISPR Tools for Engineering Prokaryotic Systems: Recent Advances and New Applications.

In the past decades, the broad selection of CRISPR-Cas systems has revolutionized biotechnology by enabling multimodal genetic manipulation in diverse organisms. Rooted in a molecular engineering perspective, we recapitulate the different CRISPR components and how they can be designed for specific genetic engineering applications. We first introduce the repertoire of Cas proteins and tethered effectors used to program new biological functions through gene editing and gene regulation.

Engineering activatable promoters for scalable and multi-input CRISPRa/i circuits.

Dynamic, multi-input gene regulatory networks (GRNs) are ubiquitous in nature. Multilayer CRISPR-based genetic circuits hold great promise for building GRNs akin to those found in naturally occurring biological systems. We develop an approach for creating high-performing activatable promoters that can be assembled into deep, wide, and multi-input CRISPR-activation and -interference (CRISPRa/i) GRNs.

Gene expression dynamics in input-responsive engineered living materials programmed for bioproduction.

Engineered living materials (ELMs) fabricated by encapsulating microbes in hydrogels have great potential as bioreactors for sustained bioproduction. While long-term metabolic activity has been demonstrated in these systems, the capacity and dynamics of gene expression over time is not well understood. Thus, we investigate the long-term gene expression dynamics in microbial ELMs constructed using different microbes and hydrogel matrices.

Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants.

CRISPR-Cas transcriptional tools have been widely applied for programmable regulation of complex biological networks. In comparison to eukaryotic systems, bacterial CRISPR activation (CRISPRa) has stringent target site requirements for effective gene activation. While genes may not always have an NGG protospacer adjacent motif (PAM) at the appropriate position, PAM-flexible dCas9 variants can expand the range of targetable sites.

Multi-layer CRISPRa/i circuits for dynamic genetic programs in cell-free and bacterial systems.

CRISPR-Cas transcriptional circuits hold great promise as platforms for engineering metabolic networks and information processing circuits. Historically, prokaryotic CRISPR control systems have been limited to CRISPRi. Creating approaches to integrate CRISPRa for transcriptional activation with existing CRISPRi-based systems would greatly expand CRISPR circuit design space.

Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida.

CRISPR-Cas transcriptional programming in bacteria is an emerging tool to regulate gene expression for metabolic pathway engineering. Here we implement CRISPR-Cas transcriptional activation (CRISPRa) in P. putida using a system previously developed in E.

Membrane Augmented Cell-Free Systems: A New Frontier in Biotechnology.

Membrane proteins are present in a wide array of cellular processes from primary and secondary metabolite synthesis to electron transport and single carbon metabolism. A key barrier to applying membrane proteins industrially is their difficult functional production. Beyond expression, folding, and membrane insertion, membrane protein activity is influenced by the physicochemical properties of the associated membrane, making it difficult to achieve optimal membrane protein performance outside the endogenous host.

Challenges and opportunities with CRISPR activation in bacteria for data-driven metabolic engineering.

Creating CRISPR gene activation (CRISPRa) technologies in industrially promising bacteria could be transformative for accelerating data-driven metabolic engineering and strain design. CRISPRa has been widely used in eukaryotes, but applications in bacterial systems have remained limited. Recent work shows that multiple features of bacterial promoters impose stringent requirements on CRISPRa-mediated gene activation.

Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements.

In bacterial systems, CRISPR-Cas transcriptional activation (CRISPRa) has the potential to dramatically expand our ability to regulate gene expression, but we lack predictive rules for designing effective gRNA target sites. Here, we identify multiple features of bacterial promoters that impose stringent requirements on CRISPRa target sites. Notably, we observe narrow, 2-4 base windows of effective sites with a periodicity corresponding to one helical turn of DNA, spanning ~40 bases and centered ~80 bases upstream of the TSS.

Isolation and Characterization of Bacterial Cellulase Producers for Biomass Deconstruction: A Microbiology Laboratory Course.

The conversion of biomass to biofuels presents a solution to one of the largest global challenges of our era, climate change. A critical part of this pipeline is the process of breaking down cellulosic sugars from plant matter to be used by microbes containing biosynthetic pathways that produce biofuels or bioproducts. In this inquiry-based course, students complete a research project that isolates cellulase-producing bacteria from samples collected from the environment.

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Methods to regulate gene expression programs in bacterial cells are limited by the absence of effective gene activators. To address this challenge, we have developed synthetic bacterial transcriptional activators in E. coli by linking activation domains to programmable CRISPR-Cas DNA binding domains.

Prospects for engineering dynamic CRISPR-Cas transcriptional circuits to improve bioproduction.

Dynamic control of gene expression is emerging as an important strategy for controlling flux in metabolic pathways and improving bioproduction of valuable compounds. Integrating dynamic genetic control tools with CRISPR-Cas transcriptional regulation could significantly improve our ability to fine-tune the expression of multiple endogenous and heterologous genes according to the state of the cell. In this mini-review, we combine an analysis of recent literature with examples from our own work to discuss the prospects and challenges of developing dynamically regulated CRISPR-Cas transcriptional control systems for applications in synthetic biology and metabolic engineering.

Regulated Expression of sgRNAs Tunes CRISPRi in E. coli.

Methods for implementing dynamically-controlled multi-gene programs could expand capabilities to engineer metabolism for efficiently producing high-value compounds. This work explores whether CRISPRi repression can be tuned in E. coli through the regulated expression of the CRISPRi machinery.

Digital logic circuits in yeast with CRISPR-dCas9 NOR gates.

Natural genetic circuits enable cells to make sophisticated digital decisions. Building equally complex synthetic circuits in eukaryotes remains difficult, however, because commonly used components leak transcriptionally, do not arbitrarily interconnect or do not have digital responses. Here, we designed dCas9-Mxi1-based NOR gates in Saccharomyces cerevisiae that allow arbitrary connectivity and large genetic circuits.

Label-free selection of RNA aptamers for metabolic engineering.

RNA aptamers can be assembled into genetic regulatory devices that sense and respond to levels of specific cellular metabolites and thus serve an integral part of designing dynamic control into engineered metabolic pathways. Here, we describe a practical method for generating specific and high affinity aptamers to enable the wider use of in vitro selection and a broader application of aptamers for metabolic engineering. Conventional selection methods involving either radioactive labeling of RNA or the use of label-free methods such as SPR to track aptamer enrichment require resources that are not widely accessible to research groups.

Kinetic folding design of aptazyme-regulated expression devices as riboswitches for metabolic engineering.

Recent developments in the fields of synthetic biology and metabolic engineering have opened the doors for the microbial production of biofuels and other valuable organic compounds. There remain, however, significant metabolic hurdles to the production of these compounds in cost-effective quantities. This is due, in part, to mismatches between the metabolic engineer's desire for high yields and the microbe's desire to survive.

Computational design of RNA parts, devices, and transcripts with kinetic folding algorithms implemented on multiprocessor clusters.

With progress toward inexpensive, large-scale DNA assembly, the demand for simulation tools that allow the rapid construction of synthetic biological devices with predictable behaviors continues to increase. By combining engineered transcript components, such as ribosome binding sites, transcriptional terminators, ligand-binding aptamers, catalytic ribozymes, and aptamer-controlled ribozymes (aptazymes), gene expression in bacteria can be fine-tuned, with many corollaries and applications in yeast and mammalian cells. The successful design of genetic constructs that implement these kinds of RNA-based control mechanisms requires modeling and analyzing kinetically determined co-transcriptional folding pathways.

Designing RNA-based genetic control systems for efficient production from engineered metabolic pathways.

Engineered metabolic pathways can be augmented with dynamic regulatory controllers to increase production titers by minimizing toxicity and helping cells maintain homeostasis. We investigated the potential for dynamic RNA-based genetic control systems to increase production through simulation analysis of an engineered p-aminostyrene (p-AS) pathway in E. coli.

Dual-selection for evolution of in vivo functional aptazymes as riboswitch parts.

Both synthetic biology and metabolic engineering are aided by the development of genetic control parts. One class of riboswitch parts that has great potential for sensing and regulation of protein levels is aptamer-coupled ribozymes (aptazymes). These devices are comprised of an aptamer domain selected to bind a particular ligand, a ribozyme domain, and a communication module that regulates the ribozyme activity based on the state of the aptamer.