A comparative study of deep eutectic solvents based on fatty acids and the effect of water on their intermolecular interactions.

In this work, intermolecular interactions among the species of fatty acids-based DESs with different hydrogen bond acceptors (HBA) in the adjacent water have been investigated using molecular dynamics (MD) simulation. The results of this work provide deep insights into understanding the water stability of the DESs based on thymol and the eutectic mixtures of choline chloride and fatty acids at a temperature of 353.15 K and atmospheric pressure.

Effect of water addition on caprylic acid: Quaternary ammonium salts (QAS) deep eutectic solvents: Characterization of their structural and dynamical properties.

Physicochemical properties of the binary mixtures based on Caprylic acid: Quaternary ammonium salts (QAS) (7:3 mol ratio) are investigated using MD simulations. Considering the hydrophobic character of eutectic solvents based on long-chain fatty acids, the stability of the binary mixtures was investigated in the adjacent water. In order to investigate the effect of water on intermolecular interactions in binary mixtures, the structural properties of the binary mixtures in the pure state and adjacent to water were investigated at 310 K.

Assessment of the properties of natural-based chiral deep eutectic solvents for chiral drug separation: insights from molecular dynamics simulation.

The structural and physicochemical properties of chiral deep eutectic solvents (DESs) consisting of racemic mixtures of menthol and acetic acid (DES1), racemic mixtures of menthol and lauric acid (DES2), and racemic mixtures of menthol and pyruvic acid (DES3) for enantioselective extraction processes are investigated. Structural results, such as the radial distribution function (RDF) and the combined distribution function (CDF), indicate that the hydroxyl hydrogen of menthol has a dominant interaction with the carbonyl oxygen of the acids in the considered DESs. The number of hydrogen bonds and non-bonded interaction energies formed between -menthol and HBDs are larger than those with -menthol, resulting in the self-diffusion coefficient of -menthol being larger than that of -menthol.

Investigation the effect of water addition on intermolecular interactions of fatty acids-based deep eutectic solvents by molecular dynamics simulations.

In this work, we focused on the interaction between hydrogen bond acceptor (HBA) and hydrogen bond doner (HBD) in the binary mixtures. The results showed that Cl anion plays a key role in the formation of DESs. Also, the structural stability of deep eutectic solvents based on fatty acids (FAs) and choline chloride (ChCl) at different ratios was investigated in water using molecular dynamics simulations.

Quantum DFT methods to explore the interaction of 1-Adamantylamine with pristine, and P, As, Al, and Ga doped BN nanotubes.

Nanostructures, nowadays, found growing applications in different scientific and industrial areas. Nano-coins, nanosheets, and nanotubes are used in medical applications as sensors or drug delivery substances. The aim of this study is to explore the adsorption of 1-Adamantylamine drug on the pristine armchair boron nitride nanotubes (BNNTs) with BNNT(5,5), BNNT(6,6), and BNNT(7,7) chirality along with the P, As, Al and Ga-doped BNNTs, using the quantum mechanical density functional methods.

The adsorption of NO, SO, and O molecules on the Al-doped stanene nanotube: a DFT study.

Adsorption of pollutant gas molecules (NO, SO, and O) on the surface of the Al-doped stanene nanotube was investigated within the first principle calculations of density functional theory (DFT). Adsorption mechanisms were studied by analyzing optimized structures, band structures, projected density of states (PDOS), charge density difference (CDD), molecular orbitals, and band theory. Investigation of charge transfer by Mulliken population showed that NO accumulated while SO and O depleted charge density on the Al-doped nanotube.

Copper (II) complexes with N, S donor pyrazole-based ligands as anticancer agents.

A group of bidentate nitrogen and sulfur donor pyrazole derivative ligands abbreviated as Na[RNCS(Pz)], Na[RNCS(Pz)], Na[RNCS(Pz)], Na[RNCS(Pz)], Na[RNCS(Pz)], where (R = Et, Ph), and their Cu (II) complexes were synthesized and characterized by spectroscopic and physicochemical methods. The crystal structure of [Cu(PhNCSPz)] was determined by X-ray crystallography analysis and the results described a distorted square planar coordination geometry for this complex. Also, the cyclic voltammetry investigations indicated that the synthesized copper complex is an electrochemically active species.

Electrochemical reduction of NO catalyzed by boron-doped C fullerene: a first-principles study.

The electrochemical reduction of nitrogen monoxide (NO) is one of the most promising approaches for converting this harmful gas into useful chemicals. Using density functional theory calculations, the work examines the potential of a single B atom doped C fullerene (CB) for catalytic reduction of NO molecules. The results demonstrate that the NO may be strongly activated over the B atom of CB, and that the subsequent reduction process can result in the formation of NH and NO molecules at low and high coverages, respectively.

Structure and dynamics of hydrophobic deep eutectic solvents composed from terpene-fatty acids investigated by molecular dynamics simulation.

Hydrophobic deep eutectic solvents (HDES) composed of Terpenes and Fatty acids have recently been the subject of great interest for removing pollutants from an aqueous environment. Despite the specific application of Hydrophobic DES and the important role of molecular dynamics simulation in predicting the properties of these compounds, not many studies have been done on their intermolecular interaction. In this work, we performed molecular dynamics simulations for the eutectic mixture based on monoterpene (Menthol, Thymol) and Fatty acids such as Caprylic Acid, Decanoic Acid, Lauric Acid, and Myristic acid.

Structural and dynamic properties of eutectic mixtures based on menthol and fatty acids derived from coconut oil: a MD simulation study.

The structural and dynamical properties of the binary mixture of Menthol (MEN) and Fatty acids (FAs) were investigated using molecular dynamics simulations. To this end, the relationship between the structural and dynamical properties of the eutectic mixtures of MEN and FAs with different molar percentages of FAs are studied. Structural properties of the eutectic mixtures were characterized by calculating the combined distribution functions (CDFs), radial distribution functions (RDFs), angular distribution functions (ADFs), hydrogen bonding networks, and spatial distribution functions (SDF).

Molecular dynamics simulation study of gold nanosheet as drug delivery vehicles for anti-HIV-1 aptamers.

The adsorption process of three aptamers with gold nanosheet (GNS) as a drug carrier has been investigated with the help of molecular dynamics simulations. The sequencing of the considered aptamers are as (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU) and (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) for AP1 and AP2, respectively. AP3 is a muted version of AP1 in which nucleotide positions 4, 6, 18, 28 and 39 have C4A, U6G, A18G, G28A, and U39C mutations.

Influence of curcumin and rosmarinic acid on disrupting the general properties of Alpha-Synuclein oligomer: Molecular dynamics simulation.

Alpha-Synuclein (αS) is a protein involved in Parkinson's disease (PD) and is probably the main cause of the pathology of the disease. During pathogenesis, αS monomers aggregate, leading to the formation of a variety of oligomeric species. Recent research studies suggest that the oligomeric toxic species may be one of the main processes for pathology and disease.

Molecular dynamics simulations of choline chloride and phenyl propionic acid deep eutectic solvents: Investigation of structural and dynamics properties.

The prediction of deep eutectic composition is hard and so far, has been distinguished by trial and error. Therefore, in this work, molecular dynamics simulations were performed for specifying the composition of the eutectic point of phenyl propionic acid (Phpr) and choline chloride (ChCl) mixtures. The distinctive properties of the Phpr and ChCl eutectic mixture at the composition of the eutectic point were investigated and were compared to other eutectic mixtures with the different mole fractions of Phpr and ChCl.

Insights into the interactions and dynamics of a DES formed by phenyl propionic acid and choline chloride.

Deep eutectic solvents (DESs) have received much attention in modern green chemistry as inexpensive and easy to handle analogous ionic liquids. This work employed molecular dynamics techniques to investigate the structure and dynamics of a DES system composed of choline chloride and phenyl propionic acid as a hydrogen bond donor and acceptor, respectively. Dynamical parameters such as mean square displacement, liquid phase self-diffusion coefficient and viscosity are calculated at the pressure of 0.

CuN doped graphene as an active electrocatalyst for oxygen reduction reaction in fuel cells: A DFT study.

Based on first-principles DFT calculations, copper-nitrogen embedded graphene (CuN-Gra) is introduced as an efficient electrocatalyst for oxygen reduction reaction (ORR) in fuel cells. The possible reaction mechanisms as well as the corresponding stationary points on potential energy surfaces are studied in acidic media. Our results indicate that dissociation of O over CuN-Gra cannot occur at normal condition due to its large energy barrier.

The Interaction of Acrolein with Pristine and N-doped TiO2 Anatase Nanoparticles: A DFT Study.

Density functional theory calculations were carried out in order to study the effects of the adsorption of acrolein molecule on the structural and electronic properties of TiO2 anatase nanoparticles. The ability of pristine and N-doped TiO2 anatase nanoparticles to recognize toxic acrolein (C3H4O) molecule was surveyed in detail. It was concluded that acrolein molecule chemisorbs on the N-doped anatase nanoparticles with large adsorption energy and small distance with respect to the nanoparticle.

Study of thermodynamic properties of solution of ampicillin sodium in methanol at T = 298.15 k.

Osmotic coefficients of the solution of Ampicillin sodium in methanol at T = 298.15 K were measured using the isopiestic technique and head space-gas chromatography. The experimental osmotic coefficients have been correlated using the ion interaction model of Pitzer, e-NRTL model of Chen, NRF and a fourth- order polynomial in terms of molality.