Monomeric iron(II) hydroxo and iron(III) dihydroxo complexes stabilized by intermolecular hydrogen bonding.

Using the multidentate ligand bis(N-methylimidazol-2-yl)-3-methylthiopropanol (L), the mononuclear iron(II) hydroxo and iron(III) dihydroxo complexes [Fe(II)(L)2(OH)](BF4) (1) and [Fe(III)(L)2(OH)2](BF4) (2) have been synthesized and characterized by X-ray diffraction and spectroscopic methods. The X-ray data suggest that the remarkable stability of the Fe-OH bond(s) in both compounds results from intermolecular hydrogen-bonding interactions between the hydroxo ligand(s) and the tertiary hydroxyl of the L ligands, which prevent further intermolecular reactions.

GA and AG sequences of DNA react with cisplatin at comparable rates.

The sequence selectivity of the antitumor drug cisplatin (cis-[PtCl(2)(NH(3))(2)] (1)) between the 5'-AG-3' and 5'-GA-3' sites of DNA has been a matter of discussion for more than twenty years. In this work, we compared the reactivity of GA and AG sequences of DNA towards the aquated forms of cisplatin (cis-[PtCl(NH(3))(2)(H(2)O)](+) (2), cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) (3), and cis-[Pt(OH)(NH(3))(2)(H(2)O)](+) (4)) using two sets of experiments. In the first, we investigated a DNA hairpin, whose duplex stem contained a TGAT sequence as the single reactive site, and determined the individual rate constants of platination with 2 and 3 for G and A in acidic solution.

Synthesis, X-ray crystal structure, and redox and electronic properties of iron(III)-polyimidazole complexes relevant to the metal sites of iron proteins.

A new tripod N(3) ligand (L), containing three imidazole rings, was synthesized in good yield. At variance with usual aromatic ligands with N(2) or N(3) donor sets such as pyridine or pyrazole derivatives, L stabilizes the Fe(III) oxidation state. The corresponding iron(III) complexes [Fe(L)Cl(3)] (1) and [Fe(L)(2)](ClO(4))(3) (2) were prepared and characterized by X-ray structural analysis and spectroscopic methods.

Platinum cross-linking of adenines and guanines on the quadruplex structures of the AG3(T2AG3)3 and (T2AG3)4 human telomere sequences in Na+ and K+ solutions.

The quadruplex structures of the human telomere sequences AG3(T2AG3)3 I and (T2AG3)4 II were investigated in the presence of Na+ and K+ ions, through the cross-linking of adenines and guanines by the cis- and trans-[Pt(NH3)2(H2O)2](NO3)2 complexes 1 and 2. The bases involved in chelation of the cis- and trans-Pt(NH3)2 moieties were identified by chemical and 3'-exonuclease digestions of the products isolated after denaturing gel electrophoresis. These are the four adenines of each sequence and four out of the 12 guanines.

Rearrangement of a 1,3-trans-[Pt(NH3)2[(GXG)-N7G,N7G]] intrastrand cross-link into interstrand cross-links within RNA duplexes.

The cross-linking reaction described previously in the DNA and 2'-O-methyl RNA series is extended to RNA duplexes. A 17mer single-stranded RNA containing the 1,3-trans-[Pt(NH3)2[(GAG)-N7G,N7G]] intrastrand chelate, named G*AG* (* indicating a platinated base) gives, upon pairing with the complementary RNA strand, the G*AG/CUC* interstrand cross-link. The rate of the reaction in 200 mM NaClO4 is similar to that observed for DNA-RNA duplexes.

Determination of platinated purines in oligoribonucleotides by limited digestion with ribonucleases T1 and U2.

Platinum complexes which are known to react preferentially with guanine (G) and adenine (A) bases of oligonucleotides can be used as tools to analyze their tertiary structures and eventually to cross-link them. However, this requires efficient methods to allow the identification and quantification of the corresponding adducts which have so far been developed only for oligodeoxyribonucleotides. Maxam-Gilbert type digestions cannot be used for RNAs and HPLC techniques would require too large amounts of expensive material for separation and further characterization.

Fast interstrand cross-linking of cisplatin-DNA monoadducts compared with intrastrand chelation: a kinetic study using hairpin-stabilized duplex oligonucleotides.

The antitumor drug cisplatin forms two kinds of guanine-guanine cross-links with DNA: intrastrand, occurring mainly at GG sites, and interstrand, formed at GC sites. The former are generally more abundant than the latter, at least in experiments with linear duplex DNA. The formation of interstrand cross-links requires partial disruption of the Watson-Crick base pairing, and one could therefore expect the cross-linking reaction to be rather slow.

Crystallographic, Electrochemical, and Pulsed EPR Study of Copper(II) Polyimidazole Complexes Relevant to the Metal Sites of Copper Proteins(,).

Copper(II) complexes of the following polyimidazole ligands have been synthesized: bis(imidazol-2-yl)methane (BIM), bis(imidazol-2-yl) ketone (BIK), 4-(imidazol-4-ylmethyl)-2-(imidazol-2-ylmethyl)imidazole (TRIM), bis[4-(imidazol-4-ylmethyl)imidazol-2-yl]methane (TIM), and bis[4-(imidazol-4-ylmethyl)imidazol-2-yl] ketone (TIK). Their crystal structures have been determined using X-ray diffraction. [Cu(ClO(4))(2)(BIM)(2)], 1, belongs to the triclinic space group P&onemacr; system, a = 7.

GG versus AG Platination: A Kinetic Study on Hairpin-Stabilized Duplex Oligonucleotides.

The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k(5)(') = 18 +/- 2 and k(3)(') = 15 +/- 1 M(-)(1) s(-)(1)), roughly twice as fast as the AG guanine of II (k(3)(') = 9 +/- 1 M(-)(1) s(-)(1)).

Platination of the (T2G4)4 telomeric sequence: a structural and cross-linking study.

The telomeric sequence (T(2)G(4))(4) was platinated in aqueous solutions containing 50 mM LiClO(4), NaClO(4), or KClO(4). The identification of the guanines which reacted with [Pt(NH(3))(3)(H(2)O)](2+) revealed that the same type of folding exists in the presence of the three cations and that the latter determine the relative stabilities of the G-quadruplex structures in the order K(+) > Na(+) >> Li(+). The tri-ammine complex yielded ca.

Determination by electrospray mass spectrometry of the outersphere association constants of DNA/platinum complexes using 20-mer oligonucleotides and ([Pt(NH(3))(4)](2+), 2Cl(-)) or ([Pt(py)(4)](2+), 2Cl(-)).

The cytotoxic effects of cisplatin, cis-diamminedichloroplatinum(II), are generally ascribed to the formation of DNA adducts. Several in vitro as well as in vivo studies showed that cisplatin binds preferentially to guanines belonging to (G)(n) sequences (n > or = 2). After mono- or diaquation of cisplatin, giving the cationic complexes cis-[PtCl(NH(3))(2)(H(2)O)](+) and cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), DNA platination occurs in two steps: the cationic complex gives an outersphere association with DNA and the actual coordination then occurs by substitution of one aqua ligand by guanine-N7.

A complete kinetic study of GG versus AG plantination suggests that the doubly aquated derivatives of cisplatin are the actual DNA binding species.

The hairpin-stabilized double-stranded oligonucleotides d(TATGGTATT4ATACCATA) (I) and d(TATAGTATT4ATACTATA) (II) were allowed to react with the three aquated forms of the antitumor drug cisplatin (cis-[PtCl2(NH3)2], 1) which are likely candidates for DNA binding, that is, cis-[PtC1(NH3)2(H2O)]+ (2), cis-[Pt(NH3)2(H2O)2]2+ (3), and its conjugate base cis-[Pt(OH)(NH3)2(H2O)]+ (4). The reaction between I and [Pt(NH3)3(H2O)]2+ (5) was also studied for comparison. All reactions were monitored by HPLC.

A Pentacoordinated Di-N-carboxamido-dithiolato-O-sulfinato-iron(III) Complex Related to the Metal Site of Nitrile Hydratase.

Postcoordination oxidation by dioxygen of one of the thiolate groups in a pentadentate N(2)S(3) ligand results in an iron(III) complex with two N-carboxamido, two thiolato, and one O-sulfinato ligands (see the CAMERON representation). This novel mixed coordination is similar to that determined for the inactive form of the nitrile hydratase from Rhodococcus sp. N-771, but differs by the O versus S binding of the sulfinato ligand.

Probing the mechanism of an Mn2+-dependent ribozyme by means of platinum complexes.

The smallest ribozyme system known is the pentanucleotide GAAACp, which is specifically cleaved by Mn2+, in the presence of poly(U), generating guanosine 2',3'-cyclic phosphate and AAACp. A plausible mechanism has been proposed, involving the participation of two Mn2+ with structural and catalytic roles, the first one cross-linking the two N7 atoms of G1 and A4, and the other binding to the N7 atom of A2 and activating the 2'-OH group of G1 [Kazakov, S. & Altman, S.

Platination of a GG site on single-stranded and double-stranded forms of a 14-base oligonucleotide with diaqua cisplatin followed by NMR and HPLC -- influence of the platinum ligands and base sequence on 5'-G versus 3'-G platination selectivity.

Detailed studies of the kinetics of platination of the single-stranded 14-base DNA oligonucleotide d(ATACATGGTACATA) and the corresponding duplex by cis-[Pt(NH3)2(H2O)2]2+ show that HPLC and NMR are complementary methods which provide similar results. The 5'-G and 3'-G monofunctional intermediates were trapped, separated and characterized by NMR (via 15NH3 labeling) and enzymatic digestion followed by mass spectrometry. The kinetic data are compared with those for the corresponding reactions of cis-[PtCl2(NH3)2] (cisplatin) and its monohydrolysed analogue.

Comparison between HPLC and capillary electrophoresis for the separation and identification of the platination products of oligonucleotides with cis-[Pt(NH3)2(H2O)2]2+ and [Pt(NH3)3(H2O)]2+.

HPLC and capillary electrophoresis (CE) were compared in order to separate the platinum adducts formed upon reaction of the double-stranded 18-mer d(AACGGTTAACCGTTAATT)2 I with the two complexes cis-[Pt(NH3)2(H2O)2]2+ 1 and [Pt(NH3)3(H2O)]2+ 2 and of the single-stranded octamer d(CTGGCTCA) II with complex 2. The GG sequence in both oligonucleotides is the only site of platination giving monoadducts on either of the two guanines or the diadduct which is the N7,N7 chelate of the Pt(NH3)(2+)2 moiety. The HPLC separation of the adducts was performed with a reverse-phase technique similar to that previously used for platinated oligonucleotides up to octamers.

Kinetic analysis of the reaction between d(TTGGCCAA) and [Pt(NH3)3(H2O)]2+ by enzymatic degradation of the products and ESI and MALDI mass spectrometries.

The kinetics of the reaction between the octanucleotide d(TTGGCCAA) in the single-stranded form in pure water and the platinum complex [Pt(NH3)3(H2O)]2+ was investigated by electrospray ionization and matrix-assisted laser desorption/ionization (MALDI) mass spectrometries coupled with enzymatic degradation of the adducts. These methods led to the determination of specific rate constants of platination. The global rate constant characteristic of the formation of adducts on each 5'- or 3'-guanine were measured by electrospray ionization analysis.

Kinetic Analysis of the Reactions between GG-Containing Oligonucleotides and Platinum Complexes. 1. Reactions of Single-Stranded Oligonucleotides with cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) and [Pt(NH(3))(3)(H(2)O)](2+).

Using concentration measurements based on high performance liquid chromatography, we have investigated the kinetics of reaction between single-stranded oligonucleotides containing a d(GpG) sequence, i.e., d(GG), d(TGG), d(TTGG), and d(CTGGCTCA), and the platinum complexes cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) (1) and [Pt(NH(3))(3)(H(2)O)](2+) (2).

Binding of the Escherichia coli UvrAB proteins to the DNA mono- and diadducts of cis-[N-2-amino-N-2-methylamino-2,2,1-bicycloheptane]dichloroplatinum(II ) and cisplatin. Analysis of the factors controlling recognition and proof of monoadduct-mediated UvrB-DNA cross-linking.

The interactions of the Escherichia coli endonuclease UvrAB proteins with the DNA mono- and diadducts of both the cis-racemic exo-[N-2-amino-N-2-methylamino-2,2,1-bicycloheptane]dichloroplatin um(II) (complex 1) and cisplatin (cis-diamminedichloroplatinum(II) (cis-DDP)), have been studied. Complex 1 reacts faster with DNA than cis-DDP and gives monoadducts with a longer lifetime (8 h 20 min chelation t 1/2 compared with 2 h 40 min for cis-DDP). Using pSP65 plasmid [3H]DNA, the filter binding assay was associated with the analysis of the nucleoprotein complexes to characterize the UvrAB recognition of the platinum adducts and to demonstrate the occurrence of platinum-mediated DNA-protein cross-linking.

Matrix-assisted laser desorption ionization time-of-flight mass spectrometry of DNA-Pt(II) complexes.

Matrix-assisted laser desorption ionization (MALDI) time-of-flight mass spectrometry has been used to characterize the reaction products of the 18-mer deoxyribonucleotide d(AACGGTTAACCGTTAATT) with [Pt(NH3)3(H2O)]2+ and cis-[Pt(NH3)2(H2O)2]2+. Characteristic peaks corresponding to different monofunctional adducts (18-mer+n[Pt(NH3)3]) (n = 1, 2, 3 and 4) have been observed with the triamino-monoaqua complex. With the diamino-diaqua cis-Pt complex, formation of a chelate (18-mer+[Pt(NH3)2]) involving two adjacent guanines has been demonstrated.

H8 chemical shifts in oligonucleotide cross-linked at a GpG sequence by cis-Pt(NH3)2(2+): a clue to the adduct structure.

The origin of the anomalous H8 chemical shifts observed in 1H-NMR spectra of oligonucleotides cross-linked at a GpG sequence with cis-[Pt(NH3)2]2+ has been investigated and clarified. The main contributions that distinguish the H8 resonances of the two platinum-ligating guanines from other GH8 signals and from each other are: (a) the inductive effect of platinum binding which we have recently quantified as a downfield shift of 0.48 +/- 0.

Synthesis and characterization of a d(ApG) platinated nonanucleotide duplex.

The nonamer 5'd(CTCAGCCTC) 3' 1 has been reacted with cis-diamminediaquaplatinum(II) in water at pH 4.2. The major reaction product was shown by enzymatic digestion and 1H NMR to be the d(ApG)cis-Pt(NH3)2 chelate [cis-Pt(NH3)2[d(CTCAGCCTC)-N7(4),N7(5)]] 1-Pt.

Investigation of sulfur containing amino acids at the lipoxygenase active site using a platinum complex.

Inactivation of native soybean lipoxygenase-1 was observed upon preincubation with (NEt4)[PtCl3(P(Bun)3)]. Removal of the platinum complex(es) from the inactivated enzyme by treatment with sodium diethyldithiocarbamate (Naddtc) which reverses methionine but not cysteine binding, restores most of the activity. Linoleic acid, an enzyme substrate, protects it from inactivation.