A tetramer of BCL11A is required for stable protein production and fetal hemoglobin silencing.

Down-regulation of BCL11A protein reverses the fetal (HbF, αγ) to adult (HbA, αβ) hemoglobin switch and is exploited in gene-based therapy for hemoglobin disorders. Because of reliance on ex vivo cell manipulation and marrow transplant, such therapies cannot lessen disease burden. To develop new small-molecule approaches, we investigated the state of BCL11A protein in erythroid cells.

Macromolecular Crowding by Polyethylene Glycol Reduces Protein Breathing.

Most efforts to understand macromolecular crowding focus on global (i.e., complete) unfolding, but smaller excursions, often called breathing, promote aggregation, which is associated with several diseases and the bane of pharmaceutical and commercial protein production.

A Difference between and In-Cell Protein Dimer Formation.

The high concentration of macromolecules in cells affects the stability of proteins and protein complexes via hard repulsions and chemical interactions, yet few studies have focused on chemical interactions. We characterized the domain-swapped dimer of the B1 domain of protein G in buffer and cells by using heteronuclear, multidimensional nuclear magnetic resonance spectroscopy. In buffer, the monomer is a partially folded molten globule, but that species is not observed in cells.

The intracellular environment affects protein-protein interactions.

Protein-protein interactions are essential for life but rarely thermodynamically quantified in living cells. In vitro efforts show that protein complex stability is modulated by high concentrations of cosolutes, including synthetic polymers, proteins, and cell lysates via a combination of hard-core repulsions and chemical interactions. We quantified the stability of a model protein complex, the A34F GB1 homodimer, in buffer, cells and oocytes.

Effects of Length and Loop Composition on Structural Diversity and Similarity of (GTGNGTG) G-Quadruplexes.

A G-rich sequence containing three loops to connect four G-tracts with each ≥2 guanines can possibly form G-quadruplex structures. Given that all G-quadruplex structures comprise the stacking of G-quartets, the loop sequence plays a major role on their folding topology and thermal stability. Here circular dichroism, NMR, and PAGE are used to study the effect of loop length and base composition in the middle loop, and a single base difference in loop 1 and 3 on G-quadruplex formation of (GHGNGHG) sequences with and without flanking nucleotides, where H is T, A, or C and N is T, A, C, or G.

Rheostatic Control of Protein Expression Using Tuner Cells.

We assessed the ability of two strains of , BL21 (DE3) and Tuner (DE3), to express a variant of the B1 domain of protein G, which forms a side-by-side dimer, by using fluorine-labeling and F nuclear magnetic resonance spectroscopy. BL21 cells express the protein in a binary, all-or-none, manner, where more cells express the protein at a high level with an increasing inducer concentration. Tuner cells express the protein in a rheostatic manner, where expression increases across all cells with an increasing inducer concentration.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure.

Comparison and Elucidation of Structural Diversity and Variation of G-Rich Sequences with a Single G-Base Difference.

Previously, we found the structural diversity of a mitochondrial sequence mt10251 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures in 20 mM K solution. Moreover, a single-base mutation of mt10251 could cause significant changes in terms of structural populations and polymorphism. In this work, we investigate the diverse G4 topologies of mt10251 and structural variation of its mutants.

Binding of Small Molecules to G-quadruplex DNA in Cells Revealed by Fluorescence Lifetime Imaging Microscopy of -BMVC Foci.

G-quadruplex (G4) structures have recently received increasing attention as a potential target for cancer research. We used time-gated fluorescence lifetime imaging microscopy (FLIM) with a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (-BMVC), to measure the number of -BMVC foci, which may represent G4 foci, in cells as a common signature to distinguish cancer cells from normal cells. Here, the decrease in the number of -BMVC foci in the pretreatment of cancer cells with TMPyP4, BRACO-19 and BMVC4 suggested that they directly bind to G4s in cells.

G-quadruplex formation by single-base mutation or deletion of mitochondrial DNA sequences.

Background: Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.

The G-quadruplex fluorescent probe 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide as a biosensor for human cancers.

Using time-gated fluorescence lifetime imaging microscopy, significantly more signals from 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide (o-BMVC) foci, characterized by the longer fluorescent decay time of o-BMVC, were detected in six types of cancer cells than in three types of normal cells. Accumulating evidence suggested that the o-BMVC foci are mainly the G-quadruplex foci. The large contrast in the number of o-BMVC foci can be considered as a common signature to distinguish cancer cells from normal cells.

A G-Quadruplex Structure in the Promoter Region of Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of . To better understand how this gene is regulated, the promoter region of was analyzed.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the gene can down-regulate its expression.