Objective: The objectives of this study were to evaluate the efficacy and toxicity of combination chemotherapy with gemcitabine and cisplatin in patients with metastatic pancreatic cancer.
Methods: Patients naïve to chemotherapy who had histologically or cytologically confirmed metastatic pancreatic adenocarcinoma were entered. Gemcitabine was given at a dose of 1000 mg/m2 over 30 min on days 1, 8 and 15, and cisplatin was given at a dose of 80 mg/m2 over 150 min on day 1, in 28-day cycles.
Introduction: Transcatheter arterial embolization (TAE) has been recognized as an effective palliative treatment option for advanced hepatocellular carcinoma (HCC). However, no effective alternative treatments for TAE-refractory HCC have yet been established. The aim of this study was to evaluate the antitumor activity and toxicity of transcatheter arterial infusion chemotherapy using an epirubicin-Lipiodol emulsion in patients with TAE-refractory HCC.
View Article and Find Full Text PDFSurveillance after curative resection for colorectal cancer is reviewed with special reference to the guidelines for colorectal cancer treatment issued by the Japanese Society for Cancer of the Colon and Rectum. The principal aim of postoperative surveillance in patients with colorectal cancer is to improve survival by early detection of a recurrence while it is still resectable. Meta-analyses from Western countries demonstrated that intensive follow-up after curative surgery improves survival.
View Article and Find Full Text PDFBackground: Survival analysis in patients with initial recurrence after curative hepatectomy for hepatocellular carcinoma (HCC) has not been well evaluated. In addition, selections of the most effective treatments for patients with recurrent HCC still remain controversial.
Methods: Three hundred and nineteen patients who underwent potentially curative hepatectomies were followed for initial recurrence, and factors predictive of recurrence were determined.
Purpose: Neoadjuvant chemoradiotherapy followed by total mesorectal excision has become the standard of care for patients with locally advanced rectal cancer. This study was designed to determine whether pretreatment cyclooxygenase-2 and p53 protein expression were predictors of histopathologic response in patients with rectal cancer treated with preoperative short-term chemoradiotherapy.
Methods: Fifty-two patients with low rectal cancer received short-term preoperative chemoradiotherapy (20 Gy given in 5 daily doses of 4 Gy and concurrent administration of Tegafur/Uracil 400 mg/day), followed by total mesorectal excision.
To establish an optimal categorization of cancer deposits without lymph node structure (extranodal cancer deposits [EX]) in a prognostic staging system, we analyzed 1,027 cases in which patients underwent potentially curative surgery for advanced colorectal adenocarcinoma. EX was classified as vascular invasion-type (VAS) or non-VAS.A total of 512 foci of EX were identified in 205 patients (20.
View Article and Find Full Text PDFObjective: To identify the parameters related to the effective selection of patients who could receive prognostic benefit from lateral pelvic node dissection.
Background: Accurate preoperative diagnosis of lateral nodal involvement (LNI) remains difficult, and the indications for lateral lymph node dissection have been controversial.
Patients And Methods: A total of 244 consecutive patients who underwent potentially curative surgery with lateral dissection for advanced lower rectal cancer (1985-2000) were reviewed.
Purpose: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities.
View Article and Find Full Text PDFBackground: Treatment of concurrent gemcitabine and radiotherapy for pancreatic cancer was reported to have a higher rate of severe acute intestinal toxicity. This study evaluated the acute intestinal toxicity in relation to the volume of irradiated small bowel and other factors using dosimetric analyses in pancreatic cancer patients treated with gemcitabine-based chemoradiotherapy.
Materials And Methods: The patient population was derived from a phase II trial of concurrent weekly gemcitabine and radiotherapy for locally advanced pancreatic cancer.
We report four patients with hepatocellular carcinoma (all men, with liver cirrhosis and hepatitis C virus infections) who showed spontaneous regression of the tumor. When the spontaneous regression occurred all of the patients were over age 67 years. They showed a rapid increase of serum alpha-fetoprotein levels just before the spontaneous regression of hepatocellular carcinoma.
View Article and Find Full Text PDFGan To Kagaku Ryoho
October 2006
We report two metastatic pancreatic cancer patients who showed marked tumor shrinkage following administration of the oral fluorinated pyrimidine anticancer drug, S-1. In the early phase II trial of S-1 for metastatic pancreatic cancer, both patients showed a partial response (Japan Society for Cancer Therapy Criteria): the reduction ratio of the tumor volume was 81.4% in the patient with liver metastasis (Case 1) and 86.
View Article and Find Full Text PDFSeveral studies have suggested that lactoferrin administration may decrease the serum level of hepatitis C virus (HCV) RNA in patients with chronic hepatitis C. The aim of the present study was to confirm the efficacy of orally administered bovine lactoferrin (bLF) in patients with chronic hepatitis C. The patients with chronic hepatitis C randomly received either oral bLF at a dose of 1.
View Article and Find Full Text PDFDendritic cells (DCs) loaded with killed allogeneic tumors can cross-prime tumor-specific naive CD8 T cells in vitro, thereby providing an option to overcome human leukocyte antigen restriction inherent to loading DC vaccines with peptides. We have vaccinated 20 patients with stage IV melanoma with autologous monocyte-derived DCs loaded with killed allogeneic Colo829 melanoma cell line. DCs were generated by culturing monocytes with granulocyte macrophage-colony stimulating factor (granulocyte macrophage-colony stimulating factor) and interleukin (IL-4) and activated by additional culture with tumor necrosis factor and CD40 ligand.
View Article and Find Full Text PDFEarly and late phase II studies of S-1 were conducted for the treatment of metastatic pancreatic cancer. In both trials, S-1 was administered at a dose of 80 mg/m2/day. One course consisted of consecutive administration of S-1 for 28 days, followed by 14 days of rest.
View Article and Find Full Text PDFBackground: Standard chemotherapy for advanced biliary tract cancer has not been established. The purpose of this study was to evaluate the efficacy and toxicity of a combination chemotherapy of uracil-tegafur (UFT) and doxorubicin in patients with unresectable advanced biliary tract cancer.
Methods: Patients with histologically or cytologically confirmed, measurable biliary tract cancer, including intrahepatic or extrahepatic cholangiocarcinoma, gallbladder cancer and ampulla of Vater cancer, which was not amenable to surgery, were eligible for the study.
Background: In an effort to improve efficacy of single-agent gemcitabine in pancreatic cancer, several studies have examined the effects of 5-FU combined with gemcitabine. However, no studies to date have been performed in Japanese patients. We thus conducted a phase I/II study of gemcitabine and infusional 5-FU in Japanese patients to determine a recommended dosage for this combination and clarify efficacy and toxicity.
View Article and Find Full Text PDFThirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.
View Article and Find Full Text PDFPurpose: The aim of this study was to assess the efficacy and toxicity of weekly irinotecan in patients with metastatic pancreatic cancer.
Patients And Methods: Patients with histologically proven pancreatic adenocarcinoma, at least one bidimensionally measurable metastatic lesion, and no prior chemotherapy were selected. Irinotecan at a dose of 100 mg/m2 was administered intravenously for 90 min on days 1, 8, and 15 every 4 weeks until disease progression or unacceptable toxicity.
A male residual schizophrenic out-patient of 65 years old had presented "heat stroke" and died in progressive course of 7 months. His mental condition had been stable and he had kept good drug compliance. In some summer day, he presented high fever and confusion, followed by convulsion.
View Article and Find Full Text PDFPurpose: Tumor budding at the invasive margin of colorectal cancer is an important adverse prognostic factor. The subset of colorectal cancer that is deficient in DNA mismatch repair has been associated with a good prognosis. It is hypothesized that tumor budding in this subset may lack biologic aggressiveness because it is not associated with aberrant expression of the independent prognostic factor, laminin-5 gamma 2.
View Article and Find Full Text PDFPurpose: In colorectal cancer, the presence of cytoplasmic podia around tumor budding foci may be a morphologic marker for an activated budding phenotype that is associated with cell motility. In this study, we have investigated the prognostic significance of cytoplasmic podia.
Methods: A total of 136 pT3 colorectal cancers were classified according to extent of budding and cytoplasmic podia as identified by immunostaining for cytokeratin.
Neuroendocrine carcinomas of the anal canal are rare, representing 1% of malignant tumors of the anal canal. This tumor behaves aggressively and leads to poor outcomes. The majority of tumors are found with distant metastases.
View Article and Find Full Text PDFBackground: In the TNM classification of colorectal carcinoma, N-staging is dependent on the number of metastases; in the Japanese classification system, staging usually has been based on the distribution of metastases (N1, paracolic; N2, along the major vessels; N3, at the root of major vessels). The aim of our study was to examine whether the concept of the distribution of nodal metastasis could improve the TNM classification for colorectal cancer.
Methods: We studied the survival rates of 485 and 136 patients with stage III colonic and rectal cancer, respectively, who underwent curative surgery between 1979 and 1998.
Objective: To determine the significance of the extent of mesorectal tumor invasion as a prognostic factor for T3 rectal cancer patients.
Summary Background Data: There is controversy as to which primary lesion characteristics, other than regional lymph node involvement, in T3 rectal cancer are reliable prognostic factors.
Patients And Methods: The extent of mesorectal tumor invasion was evaluated using 2 data sets comprising 196 and 247 patients undergoing curative surgery at separate institutes.