The evolutionary basis of premature migration in Pacific salmon highlights the utility of genomics for informing conservation.

The delineation of conservation units (CUs) is a challenging issue that has profound implications for minimizing the loss of biodiversity and ecosystem services. CU delineation typically seeks to prioritize evolutionary significance, and genetic methods play a pivotal role in the delineation process by quantifying overall differentiation between populations. Although CUs that primarily reflect overall genetic differentiation do protect adaptive differences between distant populations, they do not necessarily protect adaptive variation within highly connected populations.

A point mutation in Euglena gracilis chloroplast tRNA(Glu) uncouples protein and chlorophyll biosynthesis.

The universal precursor of tetrapyrrole pigments (e.g., chlorophylls and hemes) is 5-aminolevulinic acid (ALA), which in Euglena gracilis chloroplasts is derived via the two-step C5 pathway from glutamate charged to tRNA(Glu).

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2).

Light-harvesting systems of brown algae and diatoms. Isolation and characterization of chlorophyll a/c and chlorophyll a/fucoxanthin pigment-protein complexes.

The present study examined the protein associations and energy transfer characteristics of chlorophyll c and fucoxanthin which are the major light-harvesting pigments in the brown and diatomaceous algae. It was demonstrated that sodium dodecyl sulfate (SDS)-solubilized photosynthetic membranes of these species when subjected to SDS polyacrylamide gel electrophoresis yielded three spectrally distinct pigment-protein complexes. The slowest migrating zone was identical to complex I, the SDS-altered form of the P-700 chlorophyll a-protein.