Nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid.

The complete nucleotide sequence of citrus exocortis viroid (CEV, propagated in Gymura) and chrysanthemum stunt viroid (CSV, propagated in Cineraria) has been established, using labelling in vitro and direct RNA sequencing methods and a new screening procedure for the rapid selection of suitable RNA fragments from limited digests. The covalently closed circular single-stranded viroid RNAs consist of 371 (CEV) and 354 (CSV) nucleotides, respectively. As previously shown for potato spindle tuber viroid (PSTV, 359 nucleotides), CEV and CSV also contain a long polypurine sequence.

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate.

Nucleotide sequence and secondary structure of potato spindle tuber viroid.

The viroid of the potato spindle tuber disease (PSTV) is a covalently closed ring of 359 ribonucleotides. As a result of intramolecular base pairing, a serial arrangement of double-helical sections and internal loops form a unique rod-like secondary structure. PSTV is the first pathogen of a eukaryotic organism for which the complete molecular structure has been established.

Isolation from rat liver and sequence of a RNA fragment containing 32 nucleotides from position 5 to 36 from the 3' end of ribosomal 18S RNA.

Crude tRNA isolated from rat liver by the method of Rogg et al. (Biochem. Biophys.