Deciphering the Relationship between SARS-CoV-2 and Cancer.

Some viruses are known to be associated with the onset of specific cancers. These microorganisms, oncogenic viruses or oncoviruses, can convert normal cells into cancer cells by modulating the central metabolic pathways or hampering genomic integrity mechanisms, consequently inhibiting the apoptotic machinery and/or enhancing cell proliferation. Seven oncogenic viruses are known to promote tumorigenesis in humans: human papillomavirus (HPV), hepatitis B and C viruses (HBV, HCV), Epstein-Barr virus (EBV), human T-cell leukemia virus 1 (HTLV-1), Kaposi sarcoma-associated herpesvirus (KSHV), and Merkel cell polyomavirus (MCPyV).

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1'-uracilyl)-2-propanone on Serum Albumin Structure.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein.

Cytosine-rich oligonucleotides incorporating a non-nucleotide loop: A further step towards the obtainment of physiologically stable i-motif DNA.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(ACA) and d(C) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation.

Probing the Ca mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine.

Anti-Coronavirus Vaccines: Past Investigations on SARS-CoV-1 and MERS-CoV, the Approved Vaccines from BioNTech/Pfizer, Moderna, Oxford/AstraZeneca and others under Development Against SARSCoV- 2 Infection.

The aim of this review article is to summarize the knowledge available to date on prophylaxis achievements in the frame of the fight against Coronaviruses. This work will give an overview of what is reported in the recent literature on vaccines (under investigation or already developed like BNT162b2, mRNA-1273, and ChAdOx1-S) effective against the most pathogenic Coronaviruses (SARS-CoV-1, MERS-CoV-1, and SARS-CoV-2), with of course particular attention paid to those under development or already in use to combat the current COVID-19 (CoronaVIrus Disease 19) pandemic. Our main objective is to make a contribution to the comprehension, even at a molecular level, of what is currently ready for anti-SARS-CoV-2 prophylactic intervention, as well as to provide the reader with an overall picture of the most innovative approaches for the development of vaccines that could be of general utility in the fight against the most pathogenic Coronaviruses.

From Prebiotic Chemistry to Supramolecular Biomedical Materials: Exploring the Properties of Self-Assembling Nucleobase-Containing Peptides.

Peptides and their synthetic analogs are a class of molecules with enormous relevance as therapeutics for their ability to interact with biomacromolecules like nucleic acids and proteins, potentially interfering with biological pathways often involved in the onset and progression of pathologies of high social impact. Nucleobase-bearing peptides (nucleopeptides) and pseudopeptides (PNAs) offer further interesting possibilities related to their nucleobase-decorated nature for diagnostic and therapeutic applications, thanks to their reported ability to target complementary DNA and RNA strands. In addition, these chimeric compounds are endowed with intriguing self-assembling properties, which are at the heart of their investigation as self-replicating materials in prebiotic chemistry, as well as their application as constituents of innovative drug delivery systems and, more generally, as novel nanomaterials to be employed in biomedicine.

Nucleoside Analogs and Nucleoside Precursors as Drugs in the Fight against SARS-CoV-2 and Other Coronaviruses.

Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively.

Probing the DNA Reactivity and the Anticancer Properties of a Novel Tubercidin-Pt(II) Complex.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium . In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin.

SARS-CoV-2: Recent Reports on Antiviral Therapies Based on Lopinavir/Ritonavir, Darunavir/Umifenovir, Hydroxychloroquine, Remdesivir, Favipiravir and other Drugs for the Treatment of the New Coronavirus.

Here we report on the most recent updates on experimental drugs successfully employed in the treatment of the disease caused by SARS-CoV-2 coronavirus, also referred to as COVID-19 (COronaVIrus Disease-19). In particular, several cases of recovered patients have been reported after being treated with lopinavir/ritonavir [which is widely used to treat Human Immunodeficiency Virus (HIV) infection] in combination with the anti-flu drug oseltamivir. In addition, remdesivir, which has been previously administered to Ebola virus patients, has also proven effective in the U.

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets.

Recent Advances in Nuclear Imaging of Receptor Expression to Guide Targeted Therapies in Breast Cancer.

Breast cancer remains the most frequent cancer in women with different patterns of disease progression and response to treatments. The identification of specific biomarkers for different breast cancer subtypes has allowed the development of novel targeting agents for imaging and therapy. To date, patient management depends on immunohistochemistry analysis of receptor status on bioptic samples.

New G-Quadruplex-Forming Oligodeoxynucleotides Incorporating a Bifunctional Double-Ended Linker (DEL): Effects of DEL Size and ODNs Orientation on the Topology, Stability, and Molecularity of DEL-G-Quadruplexes.

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG₄T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG₄T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC⁻size-exclusion chromatography (HPLC⁻SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG₄T)₄.