Modular Light-Emitting Diode Shelving Systems for Scalable Optogenetics.

Optogenetic experiments rely on the controlled delivery of light to diverse biological systems. Impressive devices have been recently developed to stimulate cells and small animals with multiple wavelengths and intensities. However, existing hardware solutions are often limited to a single sample holder, and their design and cost can further limit scalability.

Optogenetics in Pancreatic Islets: Actuators and Effects.

The islets of Langerhans reside within the endocrine pancreas as highly vascularized microorgans that are responsible for the secretion of key hormones, such as insulin and glucagon. Islet function relies on a range of dynamic molecular processes that include Ca2+ waves, hormone pulses, and complex interactions between islet cell types. Dysfunction of these processes results in poor maintenance of blood glucose homeostasis and is a hallmark of diabetes.

Synthesis of Bodipy-Tagged Galactoconjugates and Evaluation of Their Antibacterial Properties.

As a development of our research on biocompatible glycoconjugate probes and specifically multi-chromophoric systems, herein, we report the synthesis and early bactericidal tests of two luminescent glycoconjugates whose basic structure is characterized by two boron dipyrromethene difluoride (BODIPY) moieties and three galactoside rings mounted on an oligophenylene ethynylene (OPE) skeleton. BODIPY fluorophores have found widespread application in many branches of biology in the last few decades. In particular, molecular platforms showing two different BODIPY groups have unique photophysical behavior useful in fluorescence imaging.

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin HTCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT) (Q), the 5'-5' stacked G4-dimer [d(CGGAGGT)] (Q), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')] (Q).

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions.

Rod-like nanostructures through amphiphilic OPE-porphyrin self-organization.

A new amphiphilic monosubstituted porphyrin functionalized by a β-D-glucoside terminated oligophenylenethylene (OPE) able to self-arrange into nano-aggregates in polar solvents has been synthesized and fully characterized in its monomeric and aggregated forms.

Case Report: Rapid renal response to venetoclax monotherapy in a CLL patient with secondary membranous glomerulonephritis.

Membranous glomerulonephritis (MGN) is a rare extra-hematological autoimmune complication of chronic lymphocytic leukemia (CLL), clinically characterized by nephrotic-range proteinuria and, less frequently, renal failure. Because of the rarity of this condition, there is no standardized treatment. Chlorambucil and fludarabine-based regimens, possibly combined with rituximab, have been historically the most frequent therapeutic approaches, with renal response obtained in about two-third of the patients.

CDK6 activity in a recurring convergent kinase network motif.

In humans, more than 500 kinases phosphorylate ~15% of all proteins in an emerging phosphorylation network. Convergent local interaction motifs, in which ≥two kinases phosphorylate the same substrate, underlie feedback loops and signal amplification events but have not been systematically analyzed. Here, we first report a network-wide computational analysis of convergent kinase-substrate relationships (cKSRs).

["New antigens" in membranous glomerulonephritis: let's take a closer look].

Membranous Nephropathy (MN) is characterized by the presence of subepithelial deposits. MN has been traditionally classified as primary if it is not associated with other pathologies, or secondary if it is associated with autoimmune diseases, infections or malignancies. The identification of target podocyte antigen was a critical point in the understanding of the disease: firstly in 2009 with M-type phospholipase A2 receptor (PLA2R) and then in 2014 with Thrombospondin Type 1 Domain Containing 7A (THSD7A).

Amino-OPE glycosides and blue light: a powerful synergy in photodynamic therapy.

Herein we report the synthesis and biological properties of sugar-conjugated oligophenylene ethynylene (OPE) dyes, used as novel photosensitizers (PSs) for photodynamic treatment (PDT) under blue light. The OPE-bearing glycosides at both ends are successfully prepared by a Pd-catalyzed Sonogashira cross-coupling reaction. The live-cell imaging studies have shown that these OPE glycosides (including glucose, mannose and maltose derivatives) efficiently penetrate the cytoplasm of cultured HeLa cancer cells.

A two-site reactive platform in the synthesis of amino-functionalized amphiphilic molecules sulfenic acids.

The synthesis of some bolaamphiphiles is described. It is a convergent approach that allows the linkage of a glucosyl derivative to a bis-functionalized platform, a copper-free Sonogashira cross-coupling. The central core was obtained from the reaction of a suitably substituted bis-sulfoxide with diethynyl benzenes.

A Curcumin-BODIPY Dyad and Its Silica Hybrid as NIR Bioimaging Probes.

In this paper we describe the synthesis of a novel bichromophoric system in which an efficient photoinduced intercomponent energy transfer process is active. The dyad consists of one subunit of curcumin and one of BODIPY and is able to emit in the far-red region, offering a large Stokes shift, capable of limiting light scattering processes for applications in microscopy. The system has been encapsulated in MCM-41 nanoparticles with dimensions between 50 and 80 nm.

Light-up photoluminescence sensing of a nerve agent simulant by a bis-porphyrin-salen-UO complex.

A luminescent bis-porphyrin-salen-UO complex, showing a significant fluorescence light-up response upon reacting with DMMP (a simulant of nerve agents), is reported. The fluorescence change of this complex by excitation at 365 nm can be clearly observed with the naked eye, and this complex was successfully employed to construct a test paper to detect nerve agents.

Bodipy-carbohydrate systems: synthesis and bio-applications.

Luminescent BODIPY-sugar probes have stimulated the attention of researchers for the potential applications of such molecular systems in bio-imaging. The presence of carbohydrate units confers unique structural and biological features, beside enhancement of water solubility and polarity. On the other hand, BODIPY (BOronDiPYrromethene) derivatives represent eclectic and functional luminescent molecules because of their outstanding photophysical properties.

Guidelines for Genetic Testing and Management of Alport Syndrome.

Genetic testing for pathogenic variants is usually undertaken to investigate the cause of persistent hematuria, especially with a family history of hematuria or kidney function impairment. Alport syndrome experts now advocate genetic testing for persistent hematuria, even when a heterozygous pathogenic or is suspected, and cascade testing of their first-degree family members because of their risk of impaired kidney function. The experts recommend too that or heterozygotes do not act as kidney donors.

A Portrait of the OPE as a Biological Agent.

Oligophenylene ethynylenes, known as OPEs, are a sequence of aromatic rings linked by triple bonds, the properties of which can be modulated by varying the length of the rigid main chain or/and the nature and position of the substituents on the aromatic units. They are luminescent molecules with high quantum yields and can be designed to enter a cell and act as antimicrobial and antiviral compounds, as biocompatible fluorescent probes directed towards target organelles in living cells, as labelling agents, as selective sensors for the detection of fibrillar and prefibrillar amyloid in the proteic field and in a fluorescence turn-on system for the detection of saccharides, as photosensitizers in photodynamic therapy (due to their capacity to highly induce toxicity after light activation), and as drug delivery systems. The antibacterial properties of OPEs have been the most studied against very popular and resistant pathogens, and in this paper the achievements of these studies are reviewed, together with almost all the other roles held by such oligomers.

Insights on safety and efficacy of renal artery denervation for uncontrolled-resistant hypertension in a high risk population with chronic kidney disease: first Italian real-world experience.

Aims: To evaluate the safety and efficacy of catheter-based radiofrequency renal sympathetic denervation (RSD) in a daily practice population of patients with uncontrolled resistant hypertension, on top of medical therapy.

Methods: Consecutive unselected patients with uncontrolled resistant hypertension undergoing RSD were enrolled. Office and ambulatory blood pressure (BP) measurements were collected at baseline and 3, 6 and 12 months after RSD.

Formalin-fixed paraffin-embedded renal biopsy tissues: an underexploited biospecimen resource for gene expression profiling in IgA nephropathy.

Primary IgA nephropathy (IgAN) diagnosis is based on IgA-dominant glomerular deposits and histological scoring is done on formalin-fixed paraffin embedded tissue (FFPE) sections using the Oxford classification. Our aim was to use this underexploited resource to extract RNA and identify genes that characterize active (endocapillary-extracapillary proliferations) and chronic (tubulo-interstitial) renal lesions in total renal cortex. RNA was extracted from archival FFPE renal biopsies of 52 IgAN patients, 22 non-IgAN and normal renal tissue of 7 kidney living donors (KLD) as controls.

Covalently Conjugated Gold-Porphyrin Nanostructures.

Gold nanoparticles show important electronic and optical properties, owing to their size, shape, and electronic structures. Indeed, gold nanoparticles containing no more than 30-40 atoms are only luminescent, while nanometer-sized gold nanoparticles only show surface plasmon resonance. Therefore, it appears that gold nanoparticles can alternatively be luminescent or plasmonic and this represents a severe restriction for their use as optical material.

Interactions of mono spermine porphyrin derivative with DNAs.

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC) in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC) .

Endogenous and artificial miRNAs explore a rich variety of conformations: a potential relationship between secondary structure and biological functionality.

Mature microRNAs are short non-coding RNA sequences which upon incorporation into the RISC ribonucleoprotein complex, play a crucial role in regulation of gene expression. However, miRNAs can exist within the cell also as free molecules fulfilling their biological activity. Therefore, it is emerging that in addition to sequence even the structure adopted by mature miRNAs might play an important role to reach the target.

Enantiomeric Recognition of α-Aminoacids by a Uranyl Salen-Bis-Porphyrin Complex.

A novel uranyl salen-bis-porphyrin complex, in which two porphyrin subunits and salen moiety were directly linked, was synthesized for the recognition of tetrabutylammonium (TBA) amino acids. This uranyl salen complex, due to the presence of porphyrins with their fluorescence properties, represents the first example of a luminescence of uranyl salen complexes. UV/Vis measurements indicate the formation of 1:1 host-guest complexes, whereas UV-vis and fluorescence studies revealed that this complex acts as a receptor for the enantiomeric recognition of α-aminoacids derivatives, with high association constants and an excellent enantiomeric discrimination between the two enantiomers of phenylalanine-TBA.

Polyethersulfone Mats Functionalized with Porphyrin for Removal of Para-nitroaniline from Aqueous Solution.

The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water.