The discriminative detection of volatile primary aliphatic diamines (VPADs) is a relevant and timely issue. This paper explores the distinctive optical features of H-type and J-type aggregates on paper-based (PB) films, namely H-PB and J-PB films, respectively, of a Lewis acidic Zn(salen)-type complex upon chemisorption of vapors of ditopic VPADs versus those of monotopic volatile amines. While volatile monotopic Lewis bases upon chemisorption give rise to mono-adducts accompanied by enhancement of the fluorescence, in contrast, VPADs act as ditopic bases forming di-adducts with distinct optical properties, leading to fluorescence quenching.
View Article and Find Full Text PDFPurpose: The aim of this research was to investigate the relationship between socio-economic inequalities and fatal and non-fatal cardiovascular events.
Methods: A systematic review of recently published cohort studies and a meta-analysis of relative risk (RR) of low compared with high socio-economic status (SES) in relation to cardiovascular incidence and mortality was conducted. Supplementary evaluations were conducted considering different proxies of SES in relation to different types of cardiovascular disease (CVD).
To establish dual-energy-derived iodine density reference values in abdominopelvic organs in a large cohort of healthy subjects. : 597 patients who underwent portal venous phase dual-energy CT scans of the abdomen were retrospectively enrolled. Iodine distribution maps were reconstructed, and regions of interest measurements were placed in abdominal and pelvic structures to obtain absolute iodine values.
View Article and Find Full Text PDFA knowledge of the complex phenomena that regulate T1 signal on Magnetic Resonance Imaging is essential in clinical practice for a more effective characterization of pathological processes. The authors review the physical basis of T1 Relaxation Time and the fundamental aspects of physics and chemistry that can influence this parameter. The main substances (water, fat, macromolecules, methemoglobin, melanin, Gadolinium, calcium) that influence T1 and the different MRI acquisition techniques that can be applied to enhance their presence in diagnostic images are then evaluated.
View Article and Find Full Text PDFChirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA.
View Article and Find Full Text PDFPost mortem hyoid bone fracture findings may be attributable to various factors, including both the onset of acute mechanical asphyxia as it happens in manual strangulation and in charred corpses. In forensic practice, the discovery of corpses burned after death to hide their real cause of death is not uncommon: in these cases, the diagnostic challenge is even greater, as the action of flames is capable of both masking previously generated lesions and/or generating new ones, as occurs for hyoid bone fractures. The case concerns a 76-year-old man found charred in his bedroom.
View Article and Find Full Text PDFThis contribution reports, through a combined thermogravimetric analysis, differential scanning calorimetry, UV-vis, powder X-ray diffraction, and Rietveld refinement analysis, on the stimuli-responsive chromic properties of a substituted Zn(salmal) Schiff-base Lewis acidic complex with unique and distinct thermo- and vapochromic characteristics. The solid complex obtained in air or by evaporation of the solvent from their THF solutions shows a marked thermochromism associated with a phase transition, unusually triggered by the reversible desorption/adsorption of one lattice water molecule. In contrast, the anhydrous solid, achieved from THF solutions of the complex by evaporation of the solvent under anhydrous conditions, behaves very differently as it does not show any absorption of water or thermochromism and exhibits varied vapochromic properties.
View Article and Find Full Text PDFRecent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions.
View Article and Find Full Text PDFBackground: The "Leo&Giulia standing for public health" project is an innovative digital health education model targeting primary school children. The project, developed during the COVID-19 pandemic, aims to educate primary school-aged children about public health issues through an animated cartoon series. It highlights the importance of early-life health promotion and the potential role of educational settings in shaping health behaviours.
View Article and Find Full Text PDFGiven the high prevalence of cardiovascular disease (CVD), we meta-analysed CVD relative risk (RR) in relation to high vs. low categories of self-reported and objectively assessed sedentary behaviours from cohort studies; in a sub-sample (n = 4 studies), the theoretical substitution of one hour spent sedentary with the same amount of time spent in light-intense physical activity was evaluated. Based on 19 studies (60,526 fatal and non-fatal CVD, 1,473,354 individuals and 13,559,139 persons-year) we estimated a 30% increased CVD risk for high vs.
View Article and Find Full Text PDFEpidemiological studies have shown that eating fish significantly reduces cardiovascular disease (CVD) incidence and mortality. However, more focused meta-analyses based on the most recent results from prospective cohort studies are needed. This systematic review and meta-analysis aims to update the association between fish intake and cardiovascular disease (CVD) risk using recent prospective studies.
View Article and Find Full Text PDFThe testis is a richly vascularized organ supplied by low-flow thin caliber vessels that are only partially detected by traditional Doppler systems, such as color and power Doppler. However, in the vascular representation, these techniques determine, albeit to different extents, a cut of the weak vessels due to the necessary application of wall filters that cut the disturbing frequencies responsible for artifacts generated by pulsations of the vascular walls and surrounding tissues. These filters cut a specific range of disturbing frequencies, regardless of whether they may be generated by low-flow vessels.
View Article and Find Full Text PDFExcess mortality estimates are considered relevant indicators of direct and indirect pandemic effects on the population. Scant data have been published on cause-specific excess mortality. Using individual-level administrative data covering the Pavia province of Italian northern Lombardy region, we provided all-cause and cause-specific raw (RMR) and age-standardized (ASMR) mortality rates in 2021 and 2015-2019, the rate ratio, and 95% confidence intervals, overall and by sex.
View Article and Find Full Text PDFThe technological development of Artificial Intelligence (AI) has grown rapidly in recent years. The applications of AI to cardiovascular imaging are various and could improve the radiologists' workflow, speeding up acquisition and post-processing time, increasing image quality and diagnostic accuracy. Several studies have already proved AI applications in Coronary Computed Tomography Angiography and Cardiac Magnetic Resonance, including automatic evaluation of calcium score, quantification of coronary stenosis and plaque analysis, or the automatic quantification of heart volumes and myocardial tissue characterization.
View Article and Find Full Text PDFTranscatheter heart valve (THV) embolization is a rare complication of transcatheter aortic valve implantation (TAVI) generally caused by malpositioning, sizing inaccuracies and pacing failures. The consequences are related to the site of embolization, ranging from a silent clinical picture when the device is stably anchored in the descending aorta to potentially fatal outcomes (e.g.
View Article and Find Full Text PDFChloroplast ascorbate peroxidases exert an important role in the maintenance of hydrogen peroxide levels in chloroplasts by using ascorbate as the specific electron donor. In this work, we performed a functional study of the stromal APX in rice (OsAPX7) and demonstrated that silencing of OsAPX7 did not impact plant growth, redox state, or photosynthesis parameters. Nevertheless, when subjected to drought stress, silenced plants (APX7i) show a higher capacity to maintain stomata aperture and photosynthesis performance, resulting in a higher tolerance when compared to non-transformed plants.
View Article and Find Full Text PDFThe possibility to monitor peptide and protein aggregation is of paramount importance in the so-called conformational diseases, as the understanding of many physiological pathways, as well as pathological processes involved in the development of such diseases, depends very much on the actual possibility to monitor biomolecule oligomeric distribution and aggregation. In this work, we report a novel experimental method to monitor protein aggregation, based on the change of the fluorescent properties of carbon dots upon protein binding. The results obtained in the case of insulin with this newly proposed experimental approach are compared with those obtained with other common experimental techniques normally used for the same purpose (circular dichroism, DLS, PICUP and ThT fluorescence).
View Article and Find Full Text PDFVaginal bleeding of the newborn is described as a normal phenomenon, occurring physiologically in a subset of baby girls as a response to decreased oestrogen levels in the postnatal period compared with in utero exposure. Here, we present the case of heavy vaginal bleeding prompting an evaluation via transabdominal ultrasound, which was ultimately diagnostic for uterus didelphys. We suggest that neonates with uterus didelphys are predisposed to heavy bleeding due to relatively larger amount of the endometrial tissue in two cavities.
View Article and Find Full Text PDFIndian J Dermatol Venereol Leprol
May 2023