GG versus AG Platination: A Kinetic Study on Hairpin-Stabilized Duplex Oligonucleotides.

The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k(5)(') = 18 +/- 2 and k(3)(') = 15 +/- 1 M(-)(1) s(-)(1)), roughly twice as fast as the AG guanine of II (k(3)(') = 9 +/- 1 M(-)(1) s(-)(1)).