Nucleic acid-binding bis-acridine orange dyes with improved properties for bioimaging and PCR applications.

Understanding the intricate interactions of molecular dyes with nucleic acids is pivotal for advancing medical and biochemical applications. In this work, we present a comprehensive study of the interplay between a novel series of bis-acridine orange (BAO) dyes and double-stranded DNA (dsDNA). These BAO dyes were intentionally designed as two acridine orange units connected by neutral linkers featuring a 2,5-disubstituted thiophene moiety.

Complex Biophysical and Computational Analyses of G-Quadruplex Ligands: The Porphyrin Stacks Back.

G-quadruplexes (G4 s), as non-canonical DNA structures, attract a great deal of research interest in the molecular biology as well as in the material science fields. The use of small molecules as ligands for G-quadruplexes has emerged as a tool to regulate gene expression and telomeres maintenance. Meso-tetrakis-(N-methyl-4-pyridyl) porphyrin (TMPyP4) was shown as one of the first ligands for G-quadruplexes and it is still widely used.

Synthetic Approaches to Novel Human Carbonic Anhydrase Isoform Inhibitors Based on Pyrrol-2-one Moiety.

New dihydro-pyrrol-2-one compounds, featuring dual sulfonamide groups, were synthesized through a one-pot, three-component approach utilizing trifluoroacetic acid as a catalyst. Computational analysis using density functional theory (DFT) and condensed Fukui function explored the structure-reactivity relationship. Evaluation against human carbonic anhydrase isoforms (hCA I, II, IX, XII) revealed potent inhibition.

Exploring the Impact of Nitrogen Doping on the Optical Properties of Carbon Dots Synthesized from Citric Acid.

The differences between bare carbon dots (CDs) and nitrogen-doped CDs synthesized from citric acid as a precursor are investigated, aiming at understanding the mechanisms of emission and the role of the doping atoms in shaping the optical properties. Despite their appealing emissive features, the origin of the peculiar excitation-dependent luminescence in doped CDs is still debated and intensively being examined. This study focuses on the identification of intrinsic and extrinsic emissive centers by using a multi-technique experimental approach and computational chemistry simulations.

Sulphur NH Group: Effects on the CO Electroreduction Capability of Phenylenediamine-Cp Cobalt Complexes.

The cobalt complex () with cyclopentadienyl and 2-aminothiophenolate ligands was investigated as a homogeneous catalyst for electrochemical CO reduction. By comparing its behavior with an analogous complex with the phenylenediamine (), the effect of sulfur atom as a substituent has been evaluated. As a result, a positive shift of the reduction potential and the reversibility of the corresponding redox process have been observed, also suggesting a higher stability of the compound with sulfur.

Selecting molecular or surface centers in carbon dots-silica hybrids to tune the optical emission: A photo-physics study down to the atomistic level.

In this work, we unveil the fluorescence features of citric acid and urea-based Carbon Dots (CDs) through a photo-physical characterization of nanoparticles synthesized, under solvent-free and open-air conditions, within silica-ordered mesoporous silica, as a potential host for solid-state emitting hybrids. Compared to CDs synthesized without silica matrices and dispersed in water, silica-CD hybrids display a broader emission in the green range whose contribution can be increased by UV and blue laser irradiation. The analysis of hybrids synthesized within different silica (MCM-48 and SBA-15) calls for an active role of the matrix in directing the synthesis toward the formation of CDs with a larger content of graphitic N and imidic groups at the expense of N-pyridinic molecules.

MD simulations explain the excess molar enthalpies in pseudo-binary mixtures of a choline chloride-based deep eutectic solvent with water or methanol.

The addition of molecular liquid cosolvents to choline chloride (ChCl)-based deep eutectic solvents (DESs) is increasingly investigated for reducing the inherently high bulk viscosities of the latter, which represent a major obstacle for potential industrial applications. The molar enthalpy of mixing, often referred to as excess molar enthalpy -a property reflecting changes in intermolecular interactions upon mixing-of the well-known ChCl/ethylene glycol (1:2 molar ratio) DES mixed with either water or methanol was recently found to be of opposite sign at 308.15 K: Mixing of the DES with water is strongly exothermic, while methanol mixtures are endothermic over the entire mixture composition range.

Towards an optimal monoclonal antibody with higher binding affinity to the receptor-binding domain of SARS-CoV-2 spike proteins from different variants.

A highly efficient and robust multiple scales in silico protocol, consisting of atomistic Molecular Dynamics (MD), coarse-grain (CG) MD, and constant-pH CG Monte Carlo (MC), has been developed and used to study the binding affinities of selected antigen-binding fragments of the monoclonal antibody (mAbs) CR3022 and several of its here optimized versions against 11 SARS-CoV-2 variants including the wild type. Totally 235,000 mAbs structures were initially generated using the RosettaAntibodyDesign software, resulting in top 10 scored CR3022-like-RBD complexes with critical mutations and compared to the native one, all having the potential to block virus-host cell interaction. Of these 10 finalists, two candidates were further identified in the CG simulations to be the best against all SARS-CoV-2 variants.

Carbon Nanodots from an In Silico Perspective.

Carbon nanodots (CNDs) are the latest and most shining rising stars among photoluminescent (PL) nanomaterials. These carbon-based surface-passivated nanostructures compete with other related PL materials, including traditional semiconductor quantum dots and organic dyes, with a long list of benefits and emerging applications. Advantages of CNDs include tunable inherent optical properties and high photostability, rich possibilities for surface functionalization and doping, dispersibility, low toxicity, and viable synthesis (top-down and bottom-up) from organic materials.

At the root of l-lysine emission in aqueous solutions.

l-lysine is an essential amino acid whose peculiar optical properties in aqueous solutions are still in search of a comprehensive explanation. In crystalline form l-lysine does not emit, but when in an aqueous solution, as the concentration increases, emits in the blue. The origin of such fluorescence is not yet clear.

Caging Polycations: Effect of Increasing Confinement on the Modes of Interaction of Spermidine With DNA Double Helices.

Polyamines have important roles in the modulation of the cellular function and are ubiquitous in cells. The polyamines putrescine, spermidine, and spermine represent the most abundant organic counterions of the negatively charged DNA in the cellular nucleus. These polyamines are known to stabilize the DNA structure and, depending on their concentration and additional salt composition, to induce DNA aggregation, which is often referred to as condensation.

Structural Features of the [C4mim][Cl] Ionic Liquid and Its Mixtures with Water: Insight from a H NMR Experimental and QM/MD Study.

The H NMR chemical shift of water exhibits non-monotonic dependence on the composition of an aqueous mixture of 1-butyl-3-methylimidazolium chloride, [C4mim][Cl], ionic liquid (IL). A clear minimum is observed for the H NMR chemical shift at a molar fraction of the IL of 0.34.

study of PEI-PEG-squalene-dsDNA polyplex formation: the delicate role of the PEG length in the binding of PEI to DNA.

Biocompatible hydrophilic polyethylene glycol (PEG) is widely used in biomedical applications, such as drug or gene delivery, tissue engineering or as an antifouling component in biomedical devices. Experimental studies have shown that the size of PEG can weaken polycation-polyanion interactions, like those between branched polyethyleneimine (b-PEI) and DNA in gene carriers, but details of its cause and underlying interactions on the atomic scale are still not clear. To better understand the interaction mechanisms in the formation of polyplexes between b-PEI-PEG based carriers and DNA, we have used a combination of tools and experiments on three multicomponent systems differing in PEG MW.

Spectroscopic and In Silico Studies on the Interaction of Substituted Pyrazolo[1,2-a]benzo[1,2,3,4]tetrazine-3-one Derivatives with c-Myc G4-DNA.

Herein we describe a combined experimental and in silico study of the interaction of a series of pyrazolo[1,2-a]benzo[1,2,3,4]tetrazin-3-one derivatives (PBTs) with parallel G-quadruplex (GQ) DNA aimed at correlating their previously reported anticancer activities and the stabilizing effects observed by us on c-myc oncogene promoter GQ structure. Circular dichroism (CD) melting experiments were performed to characterize the effect of the studied PBTs on the GQ thermal stability. CD measurements indicate that two out of the eight compounds under investigation induced a slight stabilizing effect (2-4 °C) on GQ depending on the nature and position of the substituents.

Formation of Citrazinic Acid Ions and Their Contribution to Optical and Magnetic Features of Carbon Nanodots: A Combined Experimental and Computational Approach.

The molecular model is one of the most appealing to explain the peculiar optical properties of Carbon nanodots (CNDs) and was proven to be successful for the bottom up synthesis, where a few molecules were recognized. Among the others, citrazinic acid is relevant for the synthesis of citric acid-based CNDs. Here we report a combined experimental and computational approach to discuss the formation of different protonated and deprotonated species of citrazinic acid and their contribution to vibrational and magnetic spectra.

Theoretical and Experimental Study of the Excess Thermodynamic Properties of Highly Nonideal Liquid Mixtures of Butanol Isomers + DBE.

Binary alcohol + ether liquid mixtures are of significant importance as potential biofuels or additives for internal combustion engines and attract considerable fundamental interest as model systems containing one strongly H-bonded self-associating component (alcohol) and one that is unable to do so (ether), but that can interact strongly as a H-bond acceptor. In this context, the excess thermodynamic properties of these mixtures, specifically the excess molar enthalpies and volumes ( and ), have been extensively measured. Butanol isomer + di--butyl ether (DBE) mixtures received significant attention because of interesting differences in their , changing from negative (1- and isobutanol) to positive (2- and -butanol) with increasing alkyl group branching.

Probing the supramolecular features π-π interaction of a di-iminopyrene-di-benzo-18-crown-6-ether compound: experimental and theoretical study.

A novel DPyDB-C[double bond, length as m-dash]N-18C6 compound was synthesised by linking a pyrene moiety to each phenyl group of dibenzo-18-crown-6-ether, the crown ether, through -HC[double bond, length as m-dash]N- bonds and characterized by FTIR, H-NMR, C-NMR, TGA, and DSC techniques. The quantitative C-NMR analysis revealed the presence of two position isomers. The electronic structure of the DPyDB-C[double bond, length as m-dash]N-18C6 molecule was characterized by UV-vis and fluorescence spectroscopies in four solvents with different polarities to observe particular behavior of isomers, as well as to demonstrate a possible non-bonding chemical association (such as ground- and excited-state associations, namely, to probe if there were forming dimers/excimers).

Microstructural and Dynamical Heterogeneities in Ionic Liquids.

Ionic liquids (ILs) are a special category of molten salts solely composed of ions with varied molecular symmetry and charge delocalization. The versatility in combining varied cation-anion moieties and in functionalizing ions with different atoms and molecular groups contributes to their peculiar interactions ranging from weak isotropic associations to strong, specific, and anisotropic forces. A delicate interplay among intra- and intermolecular interactions facilitates the formation of heterogeneous microstructures and liquid morphologies, which further contributes to their striking dynamical properties.

On the Charge-Transfer Excitations in Azobenzene Maleimide Compounds: A Theoretical Study.

Photoswitchable systems with charge-transfer (CT) transitions have gained much attention during the recent years because of their many emerging applications. CT transitions themselves are of fundamental importance from physical, chemical, engineering, and molecular modeling points of view because they depend on the modified intramolecular electronic structure. CT transitions in azobenzene (AB) were observed when substituted with the maleimide (MI) functional group.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times.

Pt NMR and Molecular Dynamics Simulation Study of the Solvation of [PtCl] in Water-Methanol and Water-Dimethoxyethane Binary Mixtures.

The experimental Pt NMR chemical shift, δ(Pt), of the [PtCl] anion dissolved in binary mixtures of water and a fully miscible organic solvent is extremely sensitive to the composition of the mixture at room temperature. Significantly nonlinear δ(Pt) trends as a function of solvent composition are observed in mixtures of water-methanol, or ethylene glycol, 2-methoxyethanol, and 1,2-dimethoxyethane (DME). The extent of the deviation from linearity of the δ(Pt) trend depends strongly on the nature of the organic component in these solutions, which broadly suggests preferential solvation of the [PtCl] anion by the organic molecule.

Inhomogeneity in Ethylammonium Nitrate-Acetonitrile Binary Mixtures: The Highest "Low q Excess" Reported to Date.

The binary mixtures of the ionic liquid ethylammonium nitrate with acetonitrile have been studied by means of wide- and small-angle X-ray scattering and via two different computational methods, namely, classical molecular dynamics and DFT. The recently debated odd feature in the extreme low q region of some ionic liquid-based binary mixtures is linked to density fluctuations within the system. We show how the "low q excess" is due to some nanoscopic objects which are formed at certain compositions.

Coarse-Grained Simulation of Rodlike Higher-Order Quadruplex Structures at Different Salt Concentrations.

We present a coarse-grained (CG) model of a rodlike higher-order quadruplex with explicit monovalent salts, which was developed from radial distribution functions of an underlying reference atomistic molecular dynamics simulation using inverse Monte Carlo technique. This work improves our previous CG model and extends its applicability beyond the minimal salt conditions, allowing its use at variable ionic strengths. The strategies necessary for the model development are clearly explained and discussed.

Molecular Dynamics Simulation Study of Parallel Telomeric DNA Quadruplexes at Different Ionic Strengths: Evaluation of Water and Ion Models.

Most molecular dynamics (MD) simulations of DNA quadruplexes have been performed under minimal salt conditions using the Åqvist potential parameters for the cation with the TIP3P water model. Recently, this combination of parameters has been reported to be problematic for the stability of quadruplex DNA, especially caused by the ion interactions inside or near the quadruplex channel. Here, we verify how the choice of ion parameters and water model can affect the quadruplex structural stability and the interactions with the ions outside the channel.

Rotation Dynamics Do Not Determine the Unexpected Isotropy of Methyl Radical EPR Spectra.

A simple first-principles electronic structure computation, further qc (quantum chemistry) computation, of the methyl radical gives three equal hf (hyperfine) couplings for the three protons with the unpaired electron. The corresponding dipolar tensors were notably rhombic and had different orientations and regular magnitude components, as they should, but what the overall A-tensor was seen by the electron spin is a different story! The final g = (2.002993, 2.