Interlocking G-Quadruplexes Using a G-Triad•G Connection: Implications for G-Wire Assembly.

G-quadruplexes are noncanonical structures of nucleic acids formed mainly by G-rich sequences and play crucial roles in important cellular processes. They are also increasingly used in nanotechnology for their valuable properties. Various unexpected structures of G-quadruplexes have been solved recently, including a stable G-quadruplex lacking one guanine in the G-tetrad core, harboring a vacant site.

Functional and Promiscuity Studies of Three-Residue Cyclophane Forming Enzymes Show Nonnative C-C Cross-Linked Products and Leader-Dependent Cyclization.

Enzymes catalyzing peptide macrocyclization are important biochemical tools in drug discovery. The -residue clophane-orming nzyme (3-CyFEs) are an emerging family of post-translational modifying enzymes that catalyze the formation of three-residue peptide cyclophanes. In this report, we introduce three additional 3-CyFEs, including ChlB, WnsB, and FnnB, that catalyze cyclophane formation on Tyr, Trp, and Phe, respectively.

RNA is a key component of extracellular DNA networks in Pseudomonas aeruginosa biofilms.

The extracellular matrix of bacterial biofilms consists of diverse components including polysaccharides, proteins and DNA. Extracellular RNA (eRNA) can also be present, contributing to the structural integrity of biofilms. However, technical difficulties related to the low stability of RNA make it difficult to understand the precise roles of eRNA in biofilms.

Stable bulged G-quadruplexes in the human genome: identification, experimental validation and functionalization.

DNA sequence composition determines the topology and stability of G-quadruplexes (G4s). Bulged G-quadruplex structures (G4-Bs) are a subset of G4s characterized by 3D conformations with bulges. Current search algorithms fail to capture stable G4-B, making their genome-wide study infeasible.

Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A•G•G•G•G pentad in an interlocked G-quadruplex.

93del is a 16-nucleotide G-quadruplex-forming aptamer which can inhibit the activity of the HIV-1 integrase enzyme at nanomolar concentration. Previous structural analyses of 93del using NMR spectroscopy have shown that the aptamer forms an interlocked G-quadruplex structure in K solution. Due to its exceptional stability and unique topology, 93del has been used in many different studies involving DNA G-quadruplexes, such as DNA aptamer and multimer design, as well as DNA fluorescence research.

Four-Layered Intramolecular Parallel G-Quadruplex with Non-Nucleotide Loops: An Ultra-Stable Self-Folded DNA Nano-Scaffold.

A four-stranded scaffold of nucleic acids termed G-quadruplex (G4) has found growing applications in nano- and biotechnology. Propeller loops are a hallmark of the most stable intramolecular parallel-stranded G4s. To date, propeller loops have been observed to span only a maximum of three G-tetrad layers.

Unprecedented hour-long residence time of a cation in a left-handed G-quadruplex.

Cations are critical for the folding and assembly of nucleic acids. In G-quadruplex structures, cations can bind between stacked G-tetrads and coordinate with negatively charged guanine carbonyl oxygens. They usually exchange between binding sites and with the bulk in solution with time constants ranging from sub-millisecond to seconds.

Duplexes Formed by GC Repeats Contain Alternate Slow- and Fast-Flipping G·G Base Pairs.

Aberrant expansion of the hexanucleotide GGGGCC (or GC) repeat in the human gene is the most common genetic factor found behind amyotrophic lateral sclerosis and frontotemporal dementia. The hypothesized pathways, through which the repeat expansions contribute to the pathology, involve one or more secondary structural forms of the DNA and/or RNA sequences, such as G-quadruplexes, duplexes, and hairpins. Here, we study the structures of DNA and RNA duplexes formed by GC repeats, which contain G()·G() base pairs flanked by either G·C or C·G base pairs.

The biofilm matrix scaffold of Pseudomonas aeruginosa contains G-quadruplex extracellular DNA structures.

Extracellular DNA, or eDNA, is recognised as a critical biofilm component; however, it is not understood how it forms networked matrix structures. Here, we isolate eDNA from static-culture Pseudomonas aeruginosa biofilms using ionic liquids to preserve its biophysical signatures of fluid viscoelasticity and the temperature dependency of DNA transitions. We describe a loss of eDNA network structure as resulting from a change in nucleic acid conformation, and propose that its ability to form viscoelastic structures is key to its role in building biofilm matrices.

A novel minimal motif for left-handed G-quadruplex formation.

A recent study on the left-handed G-quadruplex (LHG4) DNA revealed a 12-nt minimal motif GTGGTGGTGGTG with the ability to independently form an LHG4 and to drive an adjacent sequence to LHG4 formation. Here we have identified a second LHG4-forming motif, GGTGGTGGTGTG, and determined the X-ray crystal structure of an LHG4 involving this motif. Our structural analysis indicated the role of split guanines and single thymine loops in promoting LHG4 formation.

Bulges in left-handed G-quadruplexes.

G-quadruplex (G4) DNA structures with a left-handed backbone progression have unique and conserved structural features. Studies on sequence dependency of the structures revealed the prerequisites and some minimal motifs required for left-handed G4 formation. To extend the boundaries, we explore the adaptability of left-handed G4s towards the existence of bulges.

Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.

The triple-negative breast cancer (TNBC), a subtype of breast cancer which lacks of targeted therapies, exhibits a poor prognosis. It was shown recently that the PIM1 oncogene is highly related to the proliferation of TNBC cells. A quadruplex-duplex hybrid (QDH) forming sequence was recently found to exist near the transcription start site of PIM1.

Post-translational formation of strained cyclophanes in bacteria.

Cyclic peptide natural products have served as important drug molecules, with several examples used clinically. Enzymatic or chemical macrocyclization is the key transformation for constructing these chemotypes. Methods to generate new and diverse cyclic peptide scaffolds enabling the modular and predictable synthesis of peptide libraries are desirable in drug discovery platforms.

Guanine anchoring: a strategy for specific targeting of a G-quadruplex using short PNA, LNA and DNA molecules.

Two separate structural elements of a G-quadruplex (G4), a vacant site and a flanking single-strand, provide an opportunity for specific targeting of a particular G4 structure via dual recognition. Here, we show that a short peptide nucleic acid (PNA) can specifically recognize and bind to a G4 at sub-micromolar affinity based on both G-tetrad vacant site filling and complementary duplex formation. This sequence-guided guanine-anchoring strategy can be further developed for specific targeting of G4 structures using short DNA, LNA and PNA strands.

Intra-locked G-quadruplex structures formed by irregular DNA G-rich motifs.

G-rich DNA sequences with tracts of three or more continuous guanines (G≥3) are known to have high propensity to adopt stable G-quadruplex (G4) structures. Bioinformatic analyses suggest high prevalence of G-rich sequences with short G-tracts (G≤2) in the human genome. However, due to limited structural studies, the folding principles of such sequences remain largely unexplored and hence poorly understood.

Extracellular protein isolation from the matrix of anammox biofilm using ionic liquid extraction.

Anaerobic ammonium oxidation (anammox)-performing bacteria self-assemble into compact biofilms by expressing extracellular polymeric substances (EPS). Anammox EPS are poorly characterized, largely due to their low solubility in typical aqueous solvents. Pronase digestion achieved 19.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure.

Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides.

Cyclic dinucleotides have emerged as important secondary messengers and cell signaling molecules that regulate several cell responses. A guanine-deficit G-quadruplex structure formation by a sequence containing (4 - 1) guanines, denoting the number of G-tetrad layers, was previously reported. Here, a (4 - 1) G-quadruplex structure is shown to be capable of binding guanine-containing dinucleotides in micromolar affinity.

Bright G-Quadruplex Nanostructures Functionalized with Porphyrin Lanterns.

The intricate arrangement of numerous and closely placed chromophores on nanoscale scaffolds can lead to key photonic applications ranging from optical waveguides and antennas to signal-enhanced fluorescent sensors. In this regard, the self-assembly of dye-appended DNA sequences into programmed photonic architectures is promising. However, the dense packing of dyes can result in not only compromised DNA assembly (leading to ill-defined structures and precipitates) but also to essentially nonfluorescent systems (due to π-π aggregation).

An Unprecedented Knot-like G-Quadruplex Peripheral Motif.

A knot-like G-quadruplex peripheral structure is formed by a 7-nt DNA sequence DL7 (TGTTGGT), in which six out of its seven nucleobases participate in compact base-pairing interactions. Here, the solution NMR structure of a 24-nt DNA oligonucleotide containing the DL7 sequence shows the interaction between a two-layer anti-parallel G-quadruplex core and the peripheral knot-like structure, including the construction of two sharp turns in the DNA backbone. The formation of this novel structural element highlights the intricate properties of single-stranded DNA folding in presence of G-quadruplex-forming motifs.

NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes.

Analogous to the B- and Z-DNA structures in double-helix DNA, there exist both right- and left-handed quadruple-helix (G-quadruplex) DNA. Numerous conformations of right-handed and a few left-handed G-quadruplexes were previously observed, yet they were always identified separately. Here, we present the NMR solution and X-ray crystal structures of a right- and left-handed hybrid G-quadruplex.

Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter.

Poly (ADP-ribose) polymerase 1 (PARP1) has emerged as an attractive target for cancer therapy due to its key role in DNA repair processes. Inhibition of PARP1 in BRCA-mutated cancers has been observed to be clinically beneficial. Recent genome-mapping experiments have identified a non-canonical G-quadruplex-forming sequence containing bulges within the PARP1 promoter.

A Catalytic and Selective Scissoring Molecular Tool for Quadruplex Nucleic Acids.

A copper complex embedded in the structure of a water-soluble naphthalene diimide has been designed to bind and cleave G-quadruplex DNA. We describe the properties of this ligand, including its catalytic activity in the generation of ROS. FRET melting, CD, NMR, gel sequencing, and mass spectrometry experiments highlight a unique and unexpected selectivity in cleaving G-quadruplex sequences.

Analysis of Interactions between Telomeric i-Motif DNA and a Cyclic Tetraoxazole Compound.

The interaction of a macrocyclic tetraoxazole compound, L2H2-4OTD (1), with two aminoalkyl side chains and telomeric i-motif, was investigated by means of electrophoretic mobility shift assay, circular dichroism spectroscopy, mass spectrometry and NMR spectroscopy analyses. The results indicate that 1 interacts with the i-motif structure at two preferred binding sites.

Rotation of Guanine Amino Groups in G-Quadruplexes: A Probe for Local Structure and Ligand Binding.

Nucleic acids are dynamic molecules whose functions may depend on their conformational fluctuations and local motions. In particular, amino groups are dynamic components of nucleic acids that participate in the formation of various secondary structures such as G-quadruplexes. Here, we present a cost-efficient NMR method to quantify the rotational dynamics of guanine amino groups in G-quadruplex nucleic acids.