Publications by authors named "Fedorova O"

Previous studies with micropigs showed that conditioned suppression of respiration preceding the onset of an avoidance task was associated with increased pCO2, decreased plasma pH, decreased hematocrit, and increased blood pressure with no change in heart rate. Voluntary hypoventilation by humans, which evoked similar effects, was found to elicit increases in plasma endogenous digitalis-like factors (EDLF) and decreases in erythrocyte Na,K-ATPase. The present study investigated plasma EDLF and Na,K-ATPase activity in micropigs preceding and during avoidance sessions.

View Article and Find Full Text PDF

Vasoconstrictor and Na/K pump inhibitory properties of a bufodienolide Na/K-ATPase inhibitor, marinobufagenin, were studied in isolated rings of 2 to 3 order branches of human pulmonary arteries respectively. Marinobufagenin displayed concentration-dependent vasoconstrictor activity (0.01 to 10 mmol/L).

View Article and Find Full Text PDF

Increase in the number of seropositive subjects in the population of European and North-American regions not endemic for hepatitis E stimulated research in this field. This study was aimed at investigating the incidence of IgG antibodies to hepatitis E virus (anti-HEV-IgG) in subjects with different liver diseases and in groups at increased risk of infection in a nonendemic region. In patients with different diseases of the liver the incidence of anti-HEV-IgG varied from 5.

View Article and Find Full Text PDF

Previous studies found that regular confinement of dogs in an experimental environment preceding onset of an avoidance task was associated with increases in blood pressure and decreases in heart rate and respiration rate that were not prevented by adrenergic antagonists. The present study investigated a) whether divergent changes in blood pressure and heart rate also occur in micropigs preceding onset of an avoidance task, and b) the nature of changes in blood gases, plasma pH, plasma bicarbonate, hematocrit, and plasma electrolytes observed under these conditions. Blood pressure increased and heart rate decreased during 2-h preavoidance periods, whereas both blood pressure and heart rate were elevated during 20-min avoidance periods.

View Article and Find Full Text PDF

The new express technique based on the use of BrCN to synthesize DNA duplexes, containing non-substituted or monosubstituted pyrophosphate internucleotide bonds has been proposed. Using this technique, DNA duplexes having modified internucleotide bonds between dT and dC residues in the human NF-kappaB transcription factor recognition sequence in HIV-1 (5'-GGAAAGTCCC-3') have been prepared. We demonstrate that these internucleotide bonds within the recognition site do not prevent the formation of NF-kappaB p50 subunit complex with the corresponding duplexes.

View Article and Find Full Text PDF

Objectives: This study investigated effects of acute plasma volume expansion on plasma levels and urinary output of two endogenous Na,K-ATPase inhibitors, marinobufagenin-like and ouabain-like immunoreactive substances.

Methods: Plasma volume was expanded for 3 h via intravenous saline infusion in three groups of anesthetized dogs--nontreated (n = 5); pretreated with rabbit antidigoxin (n = 5); and pretreated with rabbit antimouse (control) antibody (n = 4).

Results: Plasma marinobufagenin-like immunoreactivity increased to 11.

View Article and Find Full Text PDF

The main aim of the study was to test the hypotheses that (a) concentrations of endogenous digoxin-like factor (EDLF) are increased in the initial period after acute myocardial infarction (AMI) and (b) may contribute to the onset of ventricular arrhythmias. 54 patients of both sexes with a first transmural AMI were included in a retrospective study. Plasma concentrations of EDLF were measured repeatedly during days 1-14 after AMI using DELFIA digoxin fluoroimmunoassay.

View Article and Find Full Text PDF

The mechanism of chemical ligation with cyanogen bromide in the presence of an N-substituted morpholine was studied. Addition of the cyano group to the tertiary nitrogen atom of the N-substituted morpholine with the formation of a quaternary ammonium cation is shown to be the first step of the reaction; it is this cation that activates the oligonucleotide phosphate group. This method of activation can be used to obtain phosphodiester derivatives of nucleotides without DNA duplex.

View Article and Find Full Text PDF

In previous studies investigators found that conditioned hypoventilatory breathing potentiated a sodium-sensitive form of hypertension in dogs that was not mediated by sympathetic nervous system arousal. Our study investigated effects of 30 minutes of voluntary hypoventilation, maintained by a respiratory gas monitor and feedback procedure, in 16 normotensive humans of both sexes on (1) plasma concentrations of endogenous digitalis-like factors (ouabain-like and marinobufagenin-like immunoreactivity), (2) activity of erythrocyte Na+, K+ -ATPase, (3) inhibitory activity of plasma Na+, K+ -ATPase, and (4) blood pressure. Increased end tidal PCO2 (41 +/- 0.

View Article and Find Full Text PDF

Kinetics of photomodification of 26-meric deoxyribonucleotide pTTGCCTTGAATGGGAA-GAGGGTCATT with derivatives of the complementary oligonucleotides pTCTTCCCATTC, pTCTTCCCA, and pTTCCCA bearing a residue of (p-azidotetrafluorobenzoyl)aminopropylamine(-ArN3) attached to the terminal phosphate (reagents I, II, and III, respectively) was studied at 37 degrees C. It was established that during irradiation the reagents are inactivated, loosing their affinity to the target. A kinetic equation describing the modification was suggested.

View Article and Find Full Text PDF

Quantitative characteristics of the modification of deoxyribooligonucleotide TTGCCTTGAATGG-GAAGAGGGTCATT (P) with 4-(N-2-chloroethyl-N-methylamino)benzyl phosphamide derivative of oligonucleotide pTTCCCA (X) were studied. The modification was performed in the presence of derivatives of the oligonucleotides (Phn-L)pTTCAAGGCp(L-Phn) (E1) and (Phn-L)pTGACCCTCp(L-Phn) (E2), where Phn is the residue of N-(2-hydroxyethyl)phenazinium, and L is ethylene diamine spacer. In PXE1, PXE2, and PXE1E2 complexes, E1, E2, and reagent X are bound with target P in tandem, with E1 near the 3'-end and E2 near the 5'-end of the reagent X.

View Article and Find Full Text PDF

The intraduplex reaction of the alkylating reagent CIRCH2NHpd(TTCCCA) (X, ClR is p-(N-2-chloroethyl-N-methylaminophenyl) residue) with the target 26-mer d(TTGCCTTGAATGGGAAGAGGGTCATT) (P) in the presence of effectors was studied. The effectors used were Phn-L-pd(TTCAAGGC)p-L-Phn (E1) and Phn-L-pd(TGACCCTC)p-L-Phy (E2), where Phn is N-(2-hydroxyethyl)-phenazinium residue and L is NHCH2CH2NH spacer. The dependence of the alkylation extent of the target on the reagent concentration was treated using the equation derived earlier for the two-component system (reagent + target) to calculate association constants of X with P, PE1, PE2 and PE1E2.

View Article and Find Full Text PDF

General equations are derived for the limit yield [PZ] infinity of the intraduplex reaction between reactive oligonucleotide derivative X bearing p-(N-2-chloroethyl-N-methyl-amino)phenyl residue and oligonucleotide target P encompassing the sequence complementary to X in the presence of one or two oligonucleotide effectors E1 and E2. The latters form the complementary tandem sequence E1-X-E2 at the target. It is shown that association constants characterizing the affinity of the reagent X to the effector containing complexes PE1, PE2 and PE1E2 may be calculated from the dependencies of [PZ] infinity on the initial concentration chi 0 of X providing the sufficient excess of effectors is present.

View Article and Find Full Text PDF

Previously, we reported that the venom of Bufo marinus toad contains a Na+,K(+)-ATPase inhibitor with potent vasoconstrictor activity. In the present study, using thin-layer chromatography in Silicagel 60 F254 + 366, we separated a vasoactive substance from a mixture of steroids from Bufo marinus venom. Based on chromatographic mobility of this substance and typical color reaction after its vizualization with SbCl3, we identified it as a previously described steroid, marinobufagenin.

View Article and Find Full Text PDF

Objectives: The aim of the study was to test the hypotheses that the concentrations of endogenous digoxin-like factor (EDLF) are (i) increased in the initial period after acute myocardial infarction (AMI) and (ii) may contribute to the genesis of ventricular arrhythmias.

Design: Consecutive sample study.

Setting: An 800-bed city teaching hospital, primary hospitalized care centre.

View Article and Find Full Text PDF

Objective: The aim was to study whether a circulating sodium pump inhibitor (endogenous digoxin-like factor) contributes to the genesis of early ventricular arrhythmias in acute myocardial ischaemia in rats.

Methods: Effects of digoxin antibody (260 micrograms.kg-1) on the incidence of ventricular arrhythmias, plasma digoxin-like immunoreactivity (DELFIA immunoassay), Na+, K+, and Mg2+ ions, and activity of the ouabain sensitive Na+, K(+)-pump in different regions of myocardium have been studied in propranolol naive and propranolol pretreated rats exposed to acute coronary artery ligation.

View Article and Find Full Text PDF

Digitalis glycoside-like properties of the Bufo marinus toad crude venom and one of its constituents, bufalin, were studied in various assay systems. In concentrations 0.3-30 micrograms/ml crude venom increased the contractility of isolated electrically driven rat atria, constricted rat aortic rings, inhibited ouabain-sensitive Na+,K(+)-ATPase in rat erythrocytes and the Na+,K(+)-pump in rat aorta, and cross-reacted with antidigoxin antibody from the dissociation enhanced lanthanide fluoroimmunoassay (DELFIA).

View Article and Find Full Text PDF

Kinetics of oligonucleotide pd(TGAATGGGAAGA) modification by a hemin derivative of the complementary oligonucleotide pd(TTCCCATT) in the presence of hydrogen peroxide was investigated. The treatment of experimental data permitted to evaluate the association and rate constants at 25 degrees C: Kx = (3.40 +/- 0.

View Article and Find Full Text PDF

Site directed alkylation of three oligonucleotide targets: 41-mer (hairpin structure), 22-mer (loop part of this hairpin) and 10-mer (part of the loop) with 5'-p-(N-2-chloroethyl-N-methylamino)benzylamides of oligonucleotides complementary to the loop region was studied. Thermodynamic parameters of the interaction were estimated using the dependence of the limit modification extent on the reagent concentration at different temperatures. The stability of the complex increases much in the set: 302-mer carrying the above hairpin, 41-mer, 22-mer; data on 22-mer and 10-mer being almost identical.

View Article and Find Full Text PDF

Human placenta and Escherichia coli Phe-tRNA(Phe) and N-AcPhe-tRNA(Phe) binding to human placenta 80S ribosomes was studied at 13 mM Mg2+ and 20 degrees C in the presence of poly(U), (pU)6 or without a template. Binding properties of both tRNA species were studied. Poly(U)-programmed 80S ribosomes were able to bind charged tRNA at A and P sites simultaneously under saturating conditions resulting in effective dipeptide formation in the case of Phe-tRNA(Phe).

View Article and Find Full Text PDF